Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants
A gene and plant technology, applied in the field of new functions of R1ytxH gene of Deinococcus radiodurans, can solve unseen problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1D
[0033] Expression of embodiment 1D.radiodurans R1ytxH gene (DR0105) in Escherichia coli
[0034] According to the published DR_0105 gene sequence in the D.radiodurans R1 genome, design a pair of PCR-specific primers to amplify the complete nucleotide sequence from D.radiodurans R1 genomic DNA:
[0035] Up 5′ATTA TCGCACGTGGGTGATGAGGC 3′;
[0036] Down 5′ACGC AGGCGATCAGTCCTGGTTTT 3'.
[0037] The part in black italics is the restriction site.
[0038] The target gene sequence was amplified from the genome of D.radiodurans R1 by PCR method, the reaction conditions were: 94°C 10min, [94°C 60sec, 55°C 30sec, 72°C 60sec] 30 cycles, 72°C 10min, the PCR product was subjected to After the gel was recovered, it was cloned on the vector pGEMT-easy, named pGEMT-ytxH, and sequenced to verify that the cloned gene was correct; then, the ytxH gene containing cohesive ends and the pRADZ3 vector containing the promoter groEL were obtained by SpeI / NdeI double digestion. The ytxH gene was ...
Embodiment 2
[0040] Example 2 Salt Tolerance Experiment Containing D.radiodurans R1ytxH Gene (DR0105) Recombinant Strain
[0041] 1. Experimental method
[0042] 1. The 2 recombinant Escherichia coli obtained in Example 1 were respectively inoculated in 20 mL of LB liquid medium (containing Amp antibiotics), and after shaking the flask for overnight culture (37° C.), they were then transferred to 100 mL of LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5.
[0043] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 4M NaCl salt solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4, Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.
[0044] 2. Experimental results
[0045] image 3 It was shown that the growth state of the JM-ytxH strain containing the D.radiodurans R1yt...
Embodiment 3
[0048] Example 3 Expression of ytxH gene (DR0105) in rapeseed and identification of salt tolerance of transgenic plants
[0049] (1) Agrobacterium-mediated transformation of rapeseed experiment
[0050] 1. Preparation of competent Agrobacterium tumefaciens EHA105
[0051] 1) Pick a single colony and inoculate it in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), and culture overnight at 28°C with shaking at 250rpm;
[0052] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), and culture at 28°C and 250rpm until OD 600 ≈0.6;
[0053] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;
[0054] 4) Discard the supernatant and wash with 2mL 20mM CaCl 2 Resuspend the pellet, aliquot 100 μL each into 1.5 mL centrifuge tubes, and store in liquid nitrogen for later use.
[0055] 2. Transformation of recombinant plasmid DNA into Agrobacterium
[0056] 1) A...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 