Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants

A gene and plant technology, applied in the field of new functions of R1ytxH gene of Deinococcus radiodurans, can solve unseen problems

Active Publication Date: 2012-07-18
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there is no research report on the function of the ytxH gene (DR0105GeneID: 1799501) in Deinococcus radiodurans R1 in improving plant salt tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants
  • Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants
  • Application of ytxH gene in deinococcus radiodurans R1 to cultivating salt-tolerant plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0033] Expression of embodiment 1D.radiodurans R1ytxH gene (DR0105) in Escherichia coli

[0034] According to the published DR_0105 gene sequence in the D.radiodurans R1 genome, design a pair of PCR-specific primers to amplify the complete nucleotide sequence from D.radiodurans R1 genomic DNA:

[0035] Up 5′ATTA TCGCACGTGGGTGATGAGGC 3′;

[0036] Down 5′ACGC AGGCGATCAGTCCTGGTTTT 3'.

[0037] The part in black italics is the restriction site.

[0038] The target gene sequence was amplified from the genome of D.radiodurans R1 by PCR method, the reaction conditions were: 94°C 10min, [94°C 60sec, 55°C 30sec, 72°C 60sec] 30 cycles, 72°C 10min, the PCR product was subjected to After the gel was recovered, it was cloned on the vector pGEMT-easy, named pGEMT-ytxH, and sequenced to verify that the cloned gene was correct; then, the ytxH gene containing cohesive ends and the pRADZ3 vector containing the promoter groEL were obtained by SpeI / NdeI double digestion. The ytxH gene was ...

Embodiment 2

[0040] Example 2 Salt Tolerance Experiment Containing D.radiodurans R1ytxH Gene (DR0105) Recombinant Strain

[0041] 1. Experimental method

[0042] 1. The 2 recombinant Escherichia coli obtained in Example 1 were respectively inoculated in 20 mL of LB liquid medium (containing Amp antibiotics), and after shaking the flask for overnight culture (37° C.), they were then transferred to 100 mL of LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5.

[0043] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 4M NaCl salt solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4, Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.

[0044] 2. Experimental results

[0045] image 3 It was shown that the growth state of the JM-ytxH strain containing the D.radiodurans R1yt...

Embodiment 3

[0048] Example 3 Expression of ytxH gene (DR0105) in rapeseed and identification of salt tolerance of transgenic plants

[0049] (1) Agrobacterium-mediated transformation of rapeseed experiment

[0050] 1. Preparation of competent Agrobacterium tumefaciens EHA105

[0051] 1) Pick a single colony and inoculate it in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), and culture overnight at 28°C with shaking at 250rpm;

[0052] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), and culture at 28°C and 250rpm until OD 600 ≈0.6;

[0053] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;

[0054] 4) Discard the supernatant and wash with 2mL 20mM CaCl 2 Resuspend the pellet, aliquot 100 μL each into 1.5 mL centrifuge tubes, and store in liquid nitrogen for later use.

[0055] 2. Transformation of recombinant plasmid DNA into Agrobacterium

[0056] 1) A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention finds that a ytxH gene (DR0105) in Deinococcus radiodurans R1 has the function of improving the adversity resistance of prokaryotes and plants. The invention constructs recombinant vectors containing the gene and the recombinant vectors are respectively transferred into prokaryotic and eukaryotic host cells. Experiments prove that the ytxH gene (DR0105) can improve the salt tolerance of prokaryotes and the transgenic plants obtained after transplanting the gene into the plants also have salt tolerance.

Description

technical field [0001] The present invention relates to the new function of Deinococcus radiodurans R1 ytxH gene (DR0105GeneID: 1799501), in particular to the application of the gene in improving the resistance of plants to salt stress. Background technique [0002] Soil salinization is a worldwide resource problem and ecological problem, which has attracted more and more attention. With the technical progress of molecular biology, the positioning, separation and transfer of genes have become a reality, which plays an important role in improving the salt tolerance of crops. [0003] Deinococcus radiodurans R1 (D.radiodurans R1) has strong resistance to ionizing radiation, UV radiation, DNA damage reagents and osmotic stress, so it has become an ideal strain for studying the adaptation mechanism of microorganisms to abiotic stress, and can also be used as a research A model species for salt tolerance in higher plants (Battista et al., 2001). Derived from a large plasmid in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C12N15/63C12N1/21C12N1/15C12N1/19C12N5/10A01H5/00C12R1/19
Inventor 林敏江世杰张维王劲赵鹏陈明
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products