Tegillarca granosa hemoglobin Tg-HbIIA and application thereof
A technology of hemoglobin and clam, applied in the direction of hemoglobin/myoglobin, application, peptide/protein components, etc., to achieve strong bactericidal effect and broad-spectrum bactericidal activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0013] 1. Extraction and reversal of RNA from blood cells of Tegillarca granosa
[0014] Take fresh cockles, draw blood from the blood sinus of the cockles with a needle tube, take 1ml of blood into a centrifuge tube, centrifuge at 3500 rpm for one minute, remove the supernatant, save the blood cells, and extract RNA with Trizol reagent. Detect the relative absorption value of A280 and A260 with an ultraviolet spectrophotometer, and use electrophoresis to check RNA integrity. Reverse RNA with M-MLV Reverse Transcriptase Kit to obtain the first strand of cDNA.
[0015] 2. Subcloning and verification of the ORF-containing cDNA of Tg-Hb gene
[0016] Design primers based on the cDNA sequence of mature peptide of Tg-Hb gene
[0017] HbIIA-ORF-F1 5'GCAAACGAGAAGAACTAAAGCAAC 3'
[0018] HbIIA-ORF-R1 5'CCATTGATGGTTGGTCCAGATA 3'
[0019] To obtain a gene fragment encoding the mature peptide of the gene. PCR reaction program: denaturation at 94°C for 4 min, 1 cycle; denaturation at 94°C for 50 ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com