Unlock instant, AI-driven research and patent intelligence for your innovation.

Tegillarca granosa hemoglobin Tg-HbIIA and application thereof

A technology of hemoglobin and clam, applied in the direction of hemoglobin/myoglobin, application, peptide/protein components, etc., to achieve strong bactericidal effect and broad-spectrum bactericidal activity

Inactive Publication Date: 2012-08-22
ZHEJIANG WANLI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The in vitro expression of invertebrate hemoglobin has not been reported yet. Due to the differences in the amino acid sequence and protein structure of hemoglobin in invertebrates and vertebrates, it is necessary to construct a suitable expression vector and find a simple and efficient expression method for shellfish hemoglobin expression. current problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tegillarca granosa hemoglobin Tg-HbIIA and application thereof
  • Tegillarca granosa hemoglobin Tg-HbIIA and application thereof
  • Tegillarca granosa hemoglobin Tg-HbIIA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0013] 1. Extraction and reversal of RNA from blood cells of Tegillarca granosa

[0014] Take fresh cockles, draw blood from the blood sinus of the cockles with a needle tube, take 1ml of blood into a centrifuge tube, centrifuge at 3500 rpm for one minute, remove the supernatant, save the blood cells, and extract RNA with Trizol reagent. Detect the relative absorption value of A280 and A260 with an ultraviolet spectrophotometer, and use electrophoresis to check RNA integrity. Reverse RNA with M-MLV Reverse Transcriptase Kit to obtain the first strand of cDNA.

[0015] 2. Subcloning and verification of the ORF-containing cDNA of Tg-Hb gene

[0016] Design primers based on the cDNA sequence of mature peptide of Tg-Hb gene

[0017] HbIIA-ORF-F1 5'GCAAACGAGAAGAACTAAAGCAAC 3'

[0018] HbIIA-ORF-R1 5'CCATTGATGGTTGGTCCAGATA 3'

[0019] To obtain a gene fragment encoding the mature peptide of the gene. PCR reaction program: denaturation at 94°C for 4 min, 1 cycle; denaturation at 94°C for 50 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to tegillarca granosa hemoglobin Tg-HbIIA and application thereof. An amino acid sequence is SEQ ID NO: 1, and a nucleotide sequence is SEQ ID NO: 2. The tegillarca granosa hemoglobin Tg-HbIIA is sued for preparing an immunity enhancer. Tegillarca granosa hemoglobin gene HbIIA fusion protein represented by the tegillarca granosa hemoglobin Tg-HbIIA has broad-spectrum bactericidal activity and has strong bactericidal effect, especially on pathogenic bacterium vibrio of aquatic animals so that a foundation is established for development of novel medicine with anti-microbial activity and novel disease preventing and curing preparation for replacing antibiotics. Compared with traditional methods for extracting hemoglobin from natural resources, by means of a preparation method for the tegillarca granosa hemoglobin Tg-HbIIA, a large scale of non-toxic hemoglobin can be prepared, low-cost scale production becomes possible, and a new way is provided for development and preparation of mariculture shellfish feed additives and bacteriosis vaccine.

Description

Technical field [0001] The present invention belongs to the technical field of hemoglobin and in vitro recombinant expression, and specifically relates to a kind of Tg-HbIIA and its application. Background technique [0002] Hemoglobin (Hb) is a large type of iron-containing respiratory protein contained in the blood of all vertebrates and some invertebrates. It has multiple biological functions and is one of the protein families with the most research value. It is rare to have hemoglobin in invertebrates. An interesting phenomenon is that there is a large amount of hemoglobin in the blood of Clam family shellfish, which is represented by Tegillarca, and the oxygen-carrying protein of most shellfish is hemocyanin, such as Abalones, clams, etc. (Lieb, et al, Proc Natl Acad Sci USA, 2001, 98:4546-4551). Some researchers have long proposed that hemocyanin is relatively primitive and gradually replaced by hemoglobin during the evolution process (Mangum, et al, Biol Bull, 1987, 173:2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/805C12N15/12C12N15/63A23K1/16A61K38/42A61P31/04
Inventor 包永波林志华董迎辉
Owner ZHEJIANG WANLI UNIV