Unlock instant, AI-driven research and patent intelligence for your innovation.

Pc-E polypeptide inhibiting aspergillus fumigatus from adhering to cornea

A technology of Aspergillus fumigatus and cornea, which is applied in the field of polypeptides that inhibit Aspergillus fumigatus from adhering to the cornea, and can solve the problem that the specific mechanism of adhesion to corneal epithelial cells is not very clear.

Inactive Publication Date: 2013-07-31
SHANDONG EYE INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the specific mechanism by which Aspergillus fumigatus adheres to corneal epithelial cells is still unclear, so the research on how to block the infection of corneal cells by Aspergillus fumigatus during the adhesion stage is still in its infancy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pc-E polypeptide inhibiting aspergillus fumigatus from adhering to cornea
  • Pc-E polypeptide inhibiting aspergillus fumigatus from adhering to cornea
  • Pc-E polypeptide inhibiting aspergillus fumigatus from adhering to cornea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Screening for polypeptides that inhibit Aspergillus fumigatus from adhering to the cornea

[0031] 1) Human corneal epithelial cells (HCEC) cultured to a monolayer were mixed with 10 10 The pfu phage-displayed 12-peptide library (product of New England Biolabs, a 12-amino-acid-long random peptide embedded in the pIII protein of M13 phage) was incubated at 37°C for 1 hr, unbound phages were washed away with PBS, and the glycine eluent was eluted. The phages bound to the surface of HCECs were amplified and titrated, and then subjected to the same two rounds of panning, and finally 14 polypeptides of phages capable of binding to HCECs were obtained. A single phage clone was picked for sequence determination, and the obtained nucleotide sequence of SEQ ID NO: 2 (AGCACGCGTAGGATTAGGAAACGGCGACTCCGCATG) was translated into a polypeptide whose amino acid sequence was SEQ ID NO: 1 (YALRPGMPQWLE).

[0032] 2) Artificial synthesis and identification of polypeptide fragm...

Embodiment 2

[0051] Embodiment 2: the preparation of complete antigen:

[0052] (1) Dissolving the Pc-E polypeptide described in the present invention in dimethyl sulfoxide (DMSO) is prepared into a 0.1 μg / μL polypeptide mother solution; water-soluble carbodiimide (EDC), N-hydroxysuccinyl Imine (NHS) and ovalbumin (OVA) were prepared with 0.01M phosphate buffered saline (PBS, pH7.5) to make 1mg / mL working solution respectively;

[0053] (2) Take 100 μL of polypeptide mother solution, add 20 μL of EDC working solution and 12 μL of NHS working solution, the molar ratio of STX, EDC, and NHS is 1:2-3:1-2, shake and react at room temperature for 3 hours, and obtain the initial reaction solution;

[0054] (3) Prepare the protein carrier with 0.01M phosphate buffered saline (PBS, pH7.5) to make a 1mg / mL working solution.

[0055] (4) The optimal molar ratio of STX and carrier protein reaction is 10:1; add the reactants in step (2) to 100 μL of carrier protein working solution, shake and react at...

Embodiment 3

[0059] Example 3: Preparation of Composite Polypeptide Eye Drops and Detection of Its Effect on Prevention and Treatment of Aspergillus Fumigatus Infection

[0060] Take a certain amount of Pc-E polypeptide freeze-dried powder and dissolve it in borate buffer, a common solvent for eye drops, to prepare eye drops with a polypeptide concentration of 0.1%, and use sodium bicarbonate to adjust the pH value to 5.5-7.5. Glucose adjusts the osmotic pressure to 270-310mOsm / kg, making it meet the standard of conventional eye drops.

[0061] 1 hr before infection, the healthy BALB / c mice were instilled with compound polypeptide eye drops, 15 min / time, for 5 consecutive times, and then the Aspergillus fumigatus (10 7 cfu) infected mouse model, continue to use compound polypeptide eye drops for prevention and treatment after infection, 15min / time, 5 times in a row, remove the cornea after 8hr, homogenate and lyse, then gradient dilution plate counting, only infection without compound poly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
control rateaaaaaaaaaa
Login to View More

Abstract

The invention relates to a Pc-E polypeptide inhibiting aspergillus fumigatus from adhering to cornea, comprising: (1) a polypeptide whose sequence is SEQ ID No: 1; (2) a polypeptide with a 70% or more homology to the polypeptide in (1) whose functions are the same as or similar to those of the polypeptide in (1). The invention also relates to a polynucleotide which is used for coding Pc-E polypeptides. The Pc-E polypeptide screened in the invention performs competitive inhibition of different degrees on the interactions between aspergillus fumigatus and corneal epithelial cells, which can specifically block the adhesion of ligands on the surface of aspergillus fumigaus to corneal epithelial cell receptors, becoming a new target of design of medicines for treating fungal keratitis, thus providing new ideas for its clinic treatment.

Description

technical field [0001] The invention belongs to the technical field of biological control of infectious eye diseases, and in particular relates to a polypeptide for inhibiting aspergillus fumigatus from adhering to the cornea. Background technique [0002] Keratitis is the most common frequently-occurring disease of the eye. The pathogenic microorganisms that cause keratitis include fungi, bacteria, viruses, and Acanthamoeba. In recent years, with the abuse of broad-spectrum antibiotics and immunosuppressants, and the widespread wearing of contact lenses, the incidence of keratitis has greatly increased. Fungal keratitis is more common in developing countries dominated by agricultural populations, and it has a tendency to increase year by year in my country. Relevant statistics show that fungal keratitis accounts for as high as 34.8% to 61.9% of infectious corneal diseases in my country. Some areas have become the leading cause of corneal blindness. Fungal keratitis is ofte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/08C07K16/14C07K19/00C12N15/31A61K38/10A61K39/42A61P31/10A61P27/02G01N33/569G01N33/577
Inventor 李思媛赵格王宜强
Owner SHANDONG EYE INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More