Gene-recombined peoriae paenibacillus, and construction method and application thereof
A Bacillus, gene recombination technology, applied in the field of genetic engineering, can solve problems such as high cost and high oxygen consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Embodiment one, Construction of Gene Recombinant Paenibacillus Peirui:
[0077] (1) PCR amplification of P 43 Promoter
[0078] According to the accession number NO.K02174 of P 43 sequence, designed primer P 43 -F: CCC AAGCTT GATAGGTGGTATGTTTCGCTTG, the underlined Hind III is the restriction site; P 43 -R: GGTTTGCTGGTCTAACATGTGTACATTCCTCTTT, the primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.; the genomic DNA of Bacillus subtilis (which can be extracted by using the CTAB method (cetyltrimethylammonium bromide) ) as a template for gene amplification, Bacillus subtilis was purchased from the China Agricultural Microorganism Culture Collection Center (ACCC), P 43 -F / P 43 -R is a primer to amplify P 43 Promoter, reaction system: 10ul of 10×amplification buffer, 200umol / L of each of the 4 dNTP (TaKaRa) mixtures, primer P 43 -F working concentration is 50pmol / L, primer P 43 -R working concentration is 50pmol / L, template DNA ...
Embodiment 2
[0087] Embodiment two, Fermentation process of polypeptide antibiotics produced by gene recombinant Paenibacillus russica:
[0088] Polypeptide antibiotics fermentation process (such as Figure 6 shown), the main process flow includes strain activation, primary seed tank fermentation culture, secondary seed tank fermentation culture and production fermenter culture.
[0089] (1) Activation of bacteria
[0090] Streak-inoculate the preserved genetically recombinant Paenibacillus russianus BC39 on the slant of LB solid seed medium. Before inoculation, sterilize the triangular flask containing the medium at 121°C for 30 minutes, and then inoculate it at 30°C after inoculation. Cultivate for 30-48 hours, prepare spore liquid, and use 5% inoculum for seed tank inoculation.
[0091] (2) Seed tank fermentation
[0092] Sterilize the first-level seed tank first, put it into the medium and then sterilize it, cool it to 30°C, put the spore liquid into the culture medium, and feed i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap