Application of astaxanthin in fetal alcohol spectrum disorders (FASD)

A technology related to astaxanthin, applied in the direction of medical preparations containing active ingredients, organic active ingredients, non-central analgesics, etc., to achieve good prevention, improve drug utilization, and reduce pain

Inactive Publication Date: 2013-01-30
SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, AST can be artificially synthesized, and in the clinical research evaluation of small clinical samples, the safety, bioavailability and effectiveness of AST have no advers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0035] Example 1 Astaxanthin inhibits the effect of alcohol on embryonic development

[0036] 0, 0.005, 0.01, 0.015, 0.02 ml / g of 25% ethanol was intraperitoneally injected into C57BL / 6J mice on day 8 of gestation (G8), 3 pregnant mice in each group, and the embryos were taken out at G10.25 under a dissecting microscope Dissect and observe its morphology, measure head length (HL), head width (HW) and head-rump length (CRL). 0.015, 0.02ml / g of 25% ethanol, 3 pregnant mice in each group, the embryos were taken out at G9.25 and the brain tissue was taken for RT-PCR and Western blot detection.

[0037]1 μg of total RNA was reverse transcribed into cDNA, and the reaction was 37°C for 15 minutes and 85°C for 5 seconds. cDNA was subjected to polymerase chain reaction PCR with Premix Taq. The primers for Otx1 are: Sense: 5'GCAGAGCGGGAATGGAAC3' (SEQ ID NO: 1), Antisense: 5'AGATGGACGAAGCAGTAGGC3' (SEQ ID NO: 2) (PCR product 239bp); the primers for Sox2 are: Sense: 5'AACCAGCGCATGGACAGC...

Example Embodiment

[0040] Example 2 The preventive effect of astaxanthin on fetal alcohol-related diseases

[0041] Thirty-five pregnant mice were randomly divided into 7 groups with 5 mice in each group, and 4 groups were injected with 25% ethanol (dissolved in lactate Ringer's injection, LR, v / v) by intraperitoneal injection at 10:30 of G8. 0.02ml / g, and intraperitoneal injection of AST (0.5, 5, 25 and 50 mg / kg, dissolved in NS) at 10:00 of G7 and G8, which is equivalent to daily doses of 1.0, 10, 50, 100 mg / day kg·d. The alcohol control group was intraperitoneally injected with 25% ethanol 0.02ml / g at 10:30 of G8, and NS 0.02ml / kg was injected intraperitoneally at 10:00 of G7 and G8. The drug control group was intraperitoneally injected with LR 0.02ml / g at 10:30 of G8, and intraperitoneally injected with AST (50mg / kg) at 10:00 of G7 and G8, which is equivalent to a total daily dose of 100mg / kg·d . The normal control group was intraperitoneally injected with LR 0.02ml / g. as follows:

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of astaxanthin in preparing a drug for treating fetal alcohol spectrum disorders (FASD). The astaxanthin not only is capable of effectively inhibiting embryonic development lag and oxidative stress index increase which are caused by alcohol but also is capable of resisting the reduction of alcoholic neurodevelopment markers. The astaxanthin is a compound capable of effectively interrupting the FASDs. Discovered for the first time in experiments that toll-like receptors (TLRs) participate in the development of the FASDs, the astaxanthin is capable of reducing the expression of TLR4-messenger ribonucleic acid (mRNA) in an embryonic body because of the alcohol, inhibiting the expression level of TLR4 and the expression level of the downstream protein of the TLR4 and reducing the inflammatory factor increase caused by the alcohol. A new way is provided by the invention for preventing and treating the fetal alcohol-related disease.

Description

technical field [0001] The present invention relates to the field of new application of astaxanthin in disease treatment, specifically, applying astaxanthin in the prevention or treatment of fetal alcohol-related diseases, from the perspective of molecular biology, the corresponding oxidation emergency markers caused by alcohol and Inhibit the symptoms of elevated inflammatory factors, thereby inhibiting the occurrence or development of fetal alcohol-related diseases. Background technique [0002] Fetal alcohol-related disorders (fetal alcohol spectrum disorders, FASD) refers to the developmental disorders of the fetus caused by the intake of alcohol by pregnant women during pregnancy, and its manifestations are mainly central nervous system developmental disorders and maxillofacial deformities. Although the adverse effects of alcohol on the fetus are widely known, the probability of alcohol abuse in pregnant women is still on the rise. It can be seen that the embryotoxicity...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/122A61P39/02A61P29/00
Inventor 彭英郑东何蕾李艺
Owner SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap