Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of astaxanthin in fetal alcohol spectrum disorders (FASD)

A technology related to astaxanthin, applied in the direction of medical preparations containing active ingredients, organic active ingredients, non-central analgesics, etc., to achieve good prevention, improve drug utilization, and reduce pain

Inactive Publication Date: 2013-01-30
SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, AST can be artificially synthesized, and in the clinical research evaluation of small clinical samples, the safety, bioavailability and effectiveness of AST have no adverse event reports
It has been reported in the literature that AST can inhibit gastric ulcer caused by alcohol, but there is no literature report that AST can be used to intervene in FASD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)
  • Application of astaxanthin in fetal alcohol spectrum disorders (FASD)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 Astaxanthin inhibits the influence of alcohol on embryonic development

[0036] Inject 0, 0.005, 0.01, 0.015, 0.02ml / g of 25% ethanol intraperitoneally into C57BL / 6J mice on day 8 of pregnancy (G8), 3 pregnant mice in each group, and take out the embryos under a dissecting microscope at G10.25 Dissect and observe its shape, measure head length (HL), head width (HW) and head-rump length (CRL); in addition, C57BL / 6J mice on day 8 of pregnancy (G8) were intraperitoneally injected with 0, 0.005, 0.01, 0.015, 0.02ml / g 25% ethanol, 3 pregnant mice in each group, the embryos were taken out at G9.25 and the brain tissue was taken for RT-PCR and Western blot detection.

[0037]1 μg of total RNA was reverse-transcribed into cDNA at 37°C for 15 minutes and 85°C for 5 seconds. cDNA was subjected to polymerase chain reaction PCR with Premix Taq. The primers for Otx1 are: sense: 5'GCAGAGCGGGAATGGAAC3' (SEQ ID NO: 1), antisense: 5'AGATGGACGAAGCAGTAGGC3' (SEQ ID NO: 2) (...

Embodiment 2

[0040] Example 2 The preventive effect of astaxanthin on fetal alcohol-related diseases

[0041] Thirty-five pregnant mice were randomly divided into 7 groups, 5 in each group, and 4 groups were intraperitoneally injected with 25% ethanol (dissolved in lactate Ringer's injection (LR), v / v) at 10:30 on G8. 0.02ml / g, and intraperitoneally inject AST (0.5, 5, 25 and 50mg / kg, dissolved in NS) at 10:00 of G7 and G8, which is equivalent to a daily dose of 1.0, 10, 50, 100mg / kg·d. In the alcohol control group, 25% ethanol 0.02ml / g was injected intraperitoneally at 10:30 in G8, and NS 0.02ml / kg was injected intraperitoneally at 10:00 in G7 and G8. The drug control group was intraperitoneally injected with LR 0.02ml / g at 10:30 of G8, and AST (50mg / kg) was injected intraperitoneally at 10:00 of G7 and G8, which is equivalent to a total daily dose of 100mg / kg·d . The normal control group was intraperitoneally injected with LR 0.02ml / g. as follows:

[0042] (1) LR (0.02ml / g for G8) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of astaxanthin in preparing a drug for treating fetal alcohol spectrum disorders (FASD). The astaxanthin not only is capable of effectively inhibiting embryonic development lag and oxidative stress index increase which are caused by alcohol but also is capable of resisting the reduction of alcoholic neurodevelopment markers. The astaxanthin is a compound capable of effectively interrupting the FASDs. Discovered for the first time in experiments that toll-like receptors (TLRs) participate in the development of the FASDs, the astaxanthin is capable of reducing the expression of TLR4-messenger ribonucleic acid (mRNA) in an embryonic body because of the alcohol, inhibiting the expression level of TLR4 and the expression level of the downstream protein of the TLR4 and reducing the inflammatory factor increase caused by the alcohol. A new way is provided by the invention for preventing and treating the fetal alcohol-related disease.

Description

technical field [0001] The present invention relates to the field of new application of astaxanthin in disease treatment, specifically, applying astaxanthin in the prevention or treatment of fetal alcohol-related diseases, from the perspective of molecular biology, the corresponding oxidation emergency markers caused by alcohol and Inhibit the symptoms of elevated inflammatory factors, thereby inhibiting the occurrence or development of fetal alcohol-related diseases. Background technique [0002] Fetal alcohol-related disorders (fetal alcohol spectrum disorders, FASD) refers to the developmental disorders of the fetus caused by the intake of alcohol by pregnant women during pregnancy, and its manifestations are mainly central nervous system developmental disorders and maxillofacial deformities. Although the adverse effects of alcohol on the fetus are widely known, the probability of alcohol abuse in pregnant women is still on the rise. It can be seen that the embryotoxicity...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/122A61P39/02A61P29/00
Inventor 彭英郑东何蕾李艺
Owner SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com