Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC)
A technology for early diagnosis of prostate cancer, applied in the field of immunology, can solve the problems of missed diagnosis or low accuracy of misjudgment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0039] 1. Primer pair
[0040] According to the above-mentioned principle of transcription-mediated amplification technology, and the reference sequence of the gene released by the NCBI nucleic acid sequence database GeneBank of the National Center for Biotechnology Information, the detection designs were respectively designed to detect the expression levels of TMPRSS2: ERG, PCA3 or PSA genes A pair of primers, both with a promoter primer and a reverse primer, wherein:
[0041] The primer pair used to detect the expression level of TMPRSS2:ERG gene is:
[0042] Promoter primer (SEQ ID NO: 1)
[0043] AAATTAATACGACTCACTATAGGGAGACGAGCGCGGCAGGAAGCCTTATTCAGTT
[0044] Reverse primer (SEQ ID NO: 4)
[0045] AGCCAGGTGTGGCGTTCCGTA
[0046] Primer pairs for detection of PCA3 gene expression level:
[0047] Promoter primer (SEQ ID NO: 2)
[0048] AAA TTAA TACGACTCACTAT AGGGAGACTCCACACACACAGGAAGCACAA
[0049] Reverse primer (SEQ ID NO: 5):
[0050] TCTAATGTCCTTCCCTCACAAGCG
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com