Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer pairs, probes and kit for early diagnosis of prostatic cancer (PC)

A technology for early diagnosis of prostate cancer, applied in the field of immunology, can solve the problems of missed diagnosis or low accuracy of misjudgment

Active Publication Date: 2013-02-06
端鹏 +2
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The combination of these three biological indicators can improve the accuracy of early diagnosis of prostate cancer, and can overcome the problems of missed diagnosis or misjudgment and low accuracy of only detecting the gene expression level of a single biological indicator

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0039] 1. Primer pair

[0040] According to the above-mentioned principle of transcription-mediated amplification technology, and the reference sequence of the gene released by the NCBI nucleic acid sequence database GeneBank of the National Center for Biotechnology Information, the detection designs were respectively designed to detect the expression levels of TMPRSS2: ERG, PCA3 or PSA genes A pair of primers, both with a promoter primer and a reverse primer, wherein:

[0041] The primer pair used to detect the expression level of TMPRSS2:ERG gene is:

[0042] Promoter primer (SEQ ID NO: 1)

[0043] AAATTAATACGACTCACTATAGGGAGACGAGCGCGGCAGGAAGCCTTATTCAGTT

[0044] Reverse primer (SEQ ID NO: 4)

[0045] AGCCAGGTGTGGCGTTCCGTA

[0046] Primer pairs for detection of PCA3 gene expression level:

[0047] Promoter primer (SEQ ID NO: 2)

[0048] AAA TTAA TACGACTCACTAT AGGGAGACTCCACACACACAGGAAGCACAA

[0049] Reverse primer (SEQ ID NO: 5):

[0050] TCTAATGTCCTTCCCTCACAAGCG

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the immunology field and relates to three groups of primer pairs and probes and a kit for early diagnosis of the PC. The three groups of the primer pairs are provided with nucleotide sequences shown by SEQ ID NO: 1and SEQ ID NO: 4, SEQ ID NO: 2 and SEQ ID NO: 5 and SEQ ID NO: 3 and SEQ ID NO: 6 respectively. Three DNA probes are marked with biotin at 3' ends and are provided with nucleotide sequences shown by SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, and luminophore is connected on amino acid radicals at * positions in the sequences. The kit for early diagnosis of the PC is provided with the three groups of the primer pairs, reverse transcriptase and RNA polymerase and streptavidin coated on the RNA polymerase, and solid phase carriers of the DNA probes are connected onto the streptavidin. According to primer pairs, probes and the kit for early diagnosis of the PC, expression levels of human body TMP RSS2: ERG, PCA3 and PSA genes to judge risks of the PC through transcription-mediated amplification techniques.

Description

technical field [0001] The invention belongs to the field of immunology, and relates to a pair of primers, a probe and a kit for early diagnosis of prostate cancer. Background technique [0002] Prostate cancer is a common and frequently-occurring disease in men. At present, the commonly used early diagnosis methods of prostate cancer include: digital rectal examination, ultrasound-guided prostate biopsy and imaging diagnosis, etc. These methods have certain limitations. Digital rectal examination is a non-specific examination method and can only be used as A screening method for cancer; some needle biopsies have poor accuracy, such as the results of tissue staining with hematoxylin-eosin, which suggest that the tumor is negative and the patient is diagnosed as a benign prostate lesion, but actually suffers from prostate cancer; imaging There are also defects in diagnosis, such as the high cost of related examination techniques of magnetic resonance imaging, which is di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
Inventor 端鹏叶欣李博
Owner 端鹏