Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant porcine interleukin 2, and encoding gene and expression method thereof

A technology of interleukin and expression method, applied in the field of recombinant porcine interleukin 2 and its coding gene, which can solve the problems of imperfect processing and modification system, host cell toxicity, non-physiological response, etc.

Active Publication Date: 2013-04-03
GENSUN INST OF BIOMEDICINE
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But at the same time, there are still many insurmountable shortcomings in the prokaryotic expression system: for example, the commonly used expression system cannot regulate the expression time and expression level, the continuous expression of some genes may have toxic effects on the host cells, and overexpression may lead to abnormal Physiological reactions, etc. More importantly, the post-translational processing and modification system of the prokaryotic expression system is imperfect, and the target protein is often expressed in the form of inclusion bodies with low biological activity
The renaturation of inclusion bodies is a complicated process, and the individual differences for different proteins are relatively large.
If the application of refolding conditions is not suitable, it will lead to mismatching of intramolecular disulfide bonds, covalent bonding or hydrophobic bonding between molecules to form aggregates, which not only reduces the specific activity rate of recombinant proteins, resulting in unqualified product quality, but also prone to precipitation Precipitation, affecting yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine interleukin 2, and encoding gene and expression method thereof
  • Recombinant porcine interleukin 2, and encoding gene and expression method thereof
  • Recombinant porcine interleukin 2, and encoding gene and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Recombinant porcine interleukin 2 gene optimization design

[0066] 1. Codon optimization

[0067] There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes into account vario...

Embodiment 2

[0090] Embodiment 2: Construction of the expression plasmid of recombinant porcine interleukin 2 gene

[0091] The fragment synthesized from the optimized recombinant porcine interleukin 2 gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing GenScript Co., Ltd.) to obtain a long-term preservation plasmid, Denote as pUC57-prIL2 plasmid. Using the pUC57-prIL2 plasmid as a template, the upstream and downstream primers were respectively introduced into NdeI and XhoI restriction sites for PCR amplification. The sequences of the primers used are as follows:

[0092] Upstream primers:

[0093] P1: GGAATTCCATATGGCTCCGACCTCGTCGTCC

[0094] Downstream primers:

[0095] P2: GCCGCTCGAGTTACGTCAGGGTAGAGTAAATGC

[0096] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase used was Phusion High-Fidelity DNA...

Embodiment 3

[0098] Example 3 Expression and Identification of Recombinant Porcine Interleukin 2 in Escherichia coli

[0099] Specific steps are as follows:

[0100] 1. The pET21b-prIL2 plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.

[0101] 2. On the second day, pick 1-4 recombinant colonies containing the pET21b-prIL2 plasmid, insert them into LB culture medium containing 100 μg / mL ampicillin, and culture them overnight at 37°C.

[0102] 3. Take 50 μL of the overnight culture and insert it into 5 mL of LB induction medium containing 100 μg / mL ampicillin, and culture at 37°C with shaking.

[0103] 4. The OD600 value of the bacterial solution was measured every 1 h after inoculation, and when the OD600=1.0, the expression was induced with 1 mmol / L IPTG (purchased from Amresco). At the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant porcine interleukin 2, and an encoding gene, an expression method, a purification method and an inclusion body renaturation method of the recombinant porcine interleukin 2, and belongs to the field of biological genetic engineering. The interleukin 2 plays an important part in immune regulation in a consequence of disease, thereby being widely used in animal disease treatments. In order to obtain a large amount of porcine interleukin 2, the escherichia coli expression system is used for performing heterologous expression to the recombinant porcine interleukin 2 gene of which the codon is optimized. In addition, because the porcine interleukin 2 in a prokaryotic expression is mostly expressed in form of inclusion body, the invention also provides an inclusion body purification method of the recombinant interleukin 2 and screens the inclusion body renaturation method. Finally, the activity of the recombinant interleukin 2 obtained according to the invention is 1.05*10<7>IU / ml and is 1.05 folds of the activity of the internationally recognized porcine interleukin 2 standard, thus the standard of industrial production is completely achieved.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interleukin 2 and its encoding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interleukin-2 (IL-2 for short) is an important cytokine produced by activated T lymphocytes, which can activate T cells, promote B cell differentiation and secrete antibodies, induce the production of interferon, and enhance The killing activity of nuclear cells and natural killer cells (NK) plays an important role in regulating the immune response of the body, and is a kind of natural immune enhancer. Commercialized recombinant human interleukin-2 in the medical field has been used in the treatment of tumors, AIDS, hepatitis B and other diseases. In animal medicine, because interleukin 2 can improve the immune response of vaccines and reduce the occurrence of diseases, it also shows broad application prospects...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/55C07K1/14C12N15/26C12N15/63C12N1/21C12P21/02C12R1/19
Inventor 马永王安良章成昌徐春林陈晨王耀方
Owner GENSUN INST OF BIOMEDICINE