Sodium/ potassium ion ratio detecting method, system and kit
A technology of potassium ions and kits, applied in the field of biomedicine, can solve the problems of direct measurement of sodium/potassium ratio, complicated operation, large error, etc., and achieve the effect of low test cost, simple operation and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] The base sequence in the DNA molecules with fluorescent labeling groups that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the fluorescent labeling group is 6-carboxyl Fluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA).
[0058] 1) Prepare standard solution samples and test solutions
[0059] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 0.7 μmol / L for later use.
[0060] Take 150 μL each of the 11 parts of the above-mentioned DNA mother solution, and add 350 μL of sodium / potassium ion ratios to 8 parts of the DNA solution, respectively 1 (100 mmol / 100 mmol), 2 (50 mmol / 25 mmol), 3 (75 mmol / 25 mmol), 4 (80mmol / 20mmol), 5 (100mmol / 20mmol), 6 (300mmol / 50mmol), 7 (70mmol / 10mmol), 8 (800mmol / 100mmol) solutions, get 8 standard solution samples;
[0061] Add 350 μL of urine s...
Embodiment 2
[0070] The base sequence in the DNA molecules that can form different G-quadruplex structures in the presence of sodium and potassium ions with fluorescent labeling groups used in this example is TTAGGGTTAGGGTTAGGGTTAGGG, and the fluorescent labeling groups used are 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA)
[0071] 1) Prepare standard solution samples and test solutions
[0072] A certain amount of DNA was dissolved in a boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA mother solution with a concentration of 1.5 μmol / L for later use.
[0073] Take 75 μL of each of the 11 parts of the above DNA mother solution, and add 425 μL of sodium / potassium ion ratios to 8 parts of the DNA solution. (40mmol / 10mmol), 5 (100mmol / 20mmol), 6 (120mmol / 20mmol), 7 (35mmol / 5mmol), 8 (80mmol / 10mmol) solutions to obtain 8 standard solution samples.
[0074]Add 425 μL of saliva sample to the other 3 DNA solutions to obtain 3 test solutions.
[00...
Embodiment 3
[0082] The base sequence in the DNA molecule capable of forming a G quadruplex with a fluorescent labeling group used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the fluorescent labeling molecules used are 3H-indocyanine dye (Cy3) and 3H- Indocyanine dye (Cy5).
[0083] 1) Prepare standard solution samples and test solutions
[0084] A certain amount of DNA was dissolved in a boric acid-borax buffer solution with a pH value of 7.4 to prepare a DNA mother solution with a concentration of 2 μmol / L for later use.
[0085] Take 300 μL each of 11 parts of the above-mentioned DNA mother solution, and add 200 μL of solutions with sodium / potassium ion ratios of 1, 2, 3, 4, 5, 6, 8, and 10 to 8 of the DNA solutions to obtain 8 standards Solution sample.
[0086] Add 200 μL of serum samples to the other 3 DNA solutions to obtain 3 test solutions.
[0087] 2) Detection analysis
[0088] The above samples were analyzed by fluorescence spectrometer respectively. All operations w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
