Supercharge Your Innovation With Domain-Expert AI Agents!

Sodium/ potassium ion ratio detecting method, system and kit

A technology of potassium ions and kits, applied in the field of biomedicine, can solve the problems of direct measurement of sodium/potassium ratio, complicated operation, large error, etc., and achieve the effect of low test cost, simple operation and high specificity

Active Publication Date: 2013-04-17
INST OF CHEM CHINESE ACAD OF SCI
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of the enzymatic method is that no special equipment is required, but the disadvantage is that it is more expensive
[0011] (5) Atomic spectrophotometry can also be used to detect potassium and sodium ions in serum, but the operation is complicated and the error is large, and it is not as simple as flame photometry
So far, there is no direct method for determining the sodium / potassium ratio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sodium/ potassium ion ratio detecting method, system and kit
  • Sodium/ potassium ion ratio detecting method, system and kit
  • Sodium/ potassium ion ratio detecting method, system and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The base sequence in the DNA molecules with fluorescent labeling groups that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the fluorescent labeling group is 6-carboxyl Fluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA).

[0058] 1) Prepare standard solution samples and test solutions

[0059] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 0.7 μmol / L for later use.

[0060] Take 150 μL each of the 11 parts of the above-mentioned DNA mother solution, and add 350 μL of sodium / potassium ion ratios to 8 parts of the DNA solution, respectively 1 (100 mmol / 100 mmol), 2 (50 mmol / 25 mmol), 3 (75 mmol / 25 mmol), 4 (80mmol / 20mmol), 5 (100mmol / 20mmol), 6 (300mmol / 50mmol), 7 (70mmol / 10mmol), 8 (800mmol / 100mmol) solutions, get 8 standard solution samples;

[0061] Add 350 μL of urine s...

Embodiment 2

[0070] The base sequence in the DNA molecules that can form different G-quadruplex structures in the presence of sodium and potassium ions with fluorescent labeling groups used in this example is TTAGGGTTAGGGTTAGGGTTAGGG, and the fluorescent labeling groups used are 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA)

[0071] 1) Prepare standard solution samples and test solutions

[0072] A certain amount of DNA was dissolved in a boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA mother solution with a concentration of 1.5 μmol / L for later use.

[0073] Take 75 μL of each of the 11 parts of the above DNA mother solution, and add 425 μL of sodium / potassium ion ratios to 8 parts of the DNA solution. (40mmol / 10mmol), 5 (100mmol / 20mmol), 6 (120mmol / 20mmol), 7 (35mmol / 5mmol), 8 (80mmol / 10mmol) solutions to obtain 8 standard solution samples.

[0074]Add 425 μL of saliva sample to the other 3 DNA solutions to obtain 3 test solutions.

[00...

Embodiment 3

[0082] The base sequence in the DNA molecule capable of forming a G quadruplex with a fluorescent labeling group used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the fluorescent labeling molecules used are 3H-indocyanine dye (Cy3) and 3H- Indocyanine dye (Cy5).

[0083] 1) Prepare standard solution samples and test solutions

[0084] A certain amount of DNA was dissolved in a boric acid-borax buffer solution with a pH value of 7.4 to prepare a DNA mother solution with a concentration of 2 μmol / L for later use.

[0085] Take 300 μL each of 11 parts of the above-mentioned DNA mother solution, and add 200 μL of solutions with sodium / potassium ion ratios of 1, 2, 3, 4, 5, 6, 8, and 10 to 8 of the DNA solutions to obtain 8 standards Solution sample.

[0086] Add 200 μL of serum samples to the other 3 DNA solutions to obtain 3 test solutions.

[0087] 2) Detection analysis

[0088] The above samples were analyzed by fluorescence spectrometer respectively. All operations w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sodium / potassium ion ratio detecting method, a sodium / potassium ion ratio detecting system and a sodium / potassium ion ratio detecting kit. The invention relates to a method for detecting a sodium / potassium ion ratio concentration. The method comprises the following steps: (1) preparing multiple solution samples with different sodium / potassium ion ratios; (2) putting the multiple solution samples under a fluorescence spectrophotometer, and testing fluorescence intensity values at a first wavelength and a second wavelength; (3) acquiring a standard curve of the sodium / potassium ion ratios; (4) adding DNA molecules with fluorescently-labeled groups and can form different G-four chain structures in the presence of sodium and potassium ions respectively into a liquid sample to be tested, and regulating pH value of the sample so as to obtain a test solution; (5) putting the test solution under the fluorescence spectrophotometer, and testing fluorescence intensity values at the first wavelength and the second wavelength; and (6) finding a corresponding sodium / potassium ion concentration ratio of the test solution in the standard curve of the sodium / potassium ion ratios according to a ratio of the fluorescence intensity value tested at the first wavelength to the fluorescence intensity value tested at the second wavelength in the step (5).

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a sodium / potassium ion ratio detection method, system and kit. Background technique [0002] Sodium and potassium ions in the human body are the main cations to maintain the physiological activities of cells, maintain the normal osmotic pressure and acid-base balance of the body, participate in the metabolism of sugar and protein, and ensure the normal function of neuromuscular. Important indicators. The levels of sodium and potassium ions in urine and serum can be clinically used to diagnose some kidney and heart diseases. [0003] The level of sodium and potassium ions in the human body is in a balanced state, and changes in its ratio have an important impact on human health. For health, monitoring the sodium / potassium ion ratio may be more important than the absolute values ​​of the two alone. Clinically, hyperaldosteronism can be diagnosed by testing the salivary sod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64
Inventor 孙红霞唐亚林向俊锋杨千帆管爱娇刘岩
Owner INST OF CHEM CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More