Preparation method and application of double-strand recombinant adeno-associated virus mediating membrane-stabilized cd40l gene capsid protein mutation
A capsid protein, 5-Y719F-CD40L-M technology, applied in the field of biotechnology and medicine, can solve the problem of less than 15% survival rate, and achieve the goal of inhibiting the growth of lung cancer, improving gene transduction efficiency, and promoting cell apoptosis. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Such as Figure 1A and Figure 1B , pcDNA3.1 + - CD40L-M construction and identification. The specific steps are: ①pcDNA3.1 + - CD40L plasmid construction and identification. Isolation of human mononuclear cells from peripheral blood; total cellular RNA extraction and cDNA transcription; RT-PCR amplification of the target gene CD40L (upstream primer: 5'-CCGGAATTCCCAGAAGATA-3', downstream primer: 5'CCGCTCGAGTCAGCTCCA-3', product size: 850bp); the target gene fragment and pcDNA3.1 were digested with restriction enzymes EcoRI and XhoI + Vector (purchased from Invitrogen) ligation; pcDNA3.1 + - CD40L plasmid transformation and characterization. ②pcDNA3.1 + - CD40L-M plasmid construction and identification. Clone pcDNA3.1 from source + -CD40L designed and synthesized primers to introduce variation points (Q 114 K 115 D. 117 Q 118 N 119 for P 114 R 115 E. 117 E. 118 D.119 ); the high-fidelity DNA polymerase platinum pfx DNA Polymerase (Invitrogen) was used fo...
Embodiment 2
[0061] Such as Figure 2A and 2B , pdsAAV-CB-CD40L-M plasmid construction and identification. The specific steps are: ① amplify pcDNA3.1 + -CD40L-M and pdsAAV-CB-GFP, primers are T7 and T405-R (T405-R: CTTAGGAGCTCGTCGACGTCGAGGCTGATCAGCGGGT), CD405-R primers added SacI restriction site and protective base; then double digestion with BamHI and SacI The PCR product was cloned into the target vector pdsAAV-CB-GFP; a single clone was selected for bacterial inspection, and the positive clone was sequenced to obtain a clone consistent with the standard sequence.
Embodiment 3
[0063] Such as Figure 3A , the base sequence of about 730 sites on the surface of the AAV shell of different serotypes and the construction of AAV2 / 5 mutation sites. Homologous alignment and crystal structure analysis of AAV2 and AAV2 / 5 genes confirmed that the amino acid at position 719 on the surface of AAV5 capsid protein corresponds to the tyrosine residue at position 730 of AAV2 capsid protein. Use Quik IISite-Directed Mutagenesis Kit (Alignment Technologies) standard point mutation kit. Synthesize the mutant strand first: denature the DNA template, anneal to the mutant primer containing the desired mutation, use Pfu DNA polymerase was used for primer extension to construct the pAAV2 / 5-Y719F-R / C plasmid with point mutation of tyrosine (Y) coding base at position 719 of AAV2 / 5 virus coat protein to phenylalanine (F) coding base (Primer AAV2 / 5-Y719-F: CCCATTGGCACCAGATTCCTGACGCGTAATCTGTAATTGCTTG, AAV2 / 5-Y719-R: CAAGCAATTACAGATTACGCGTCAGGAATCTGGTGCCAATGGG). DpnI digest...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
