Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation method and application of double-strand recombinant adeno-associated virus mediating membrane-stabilized cd40l gene capsid protein mutation

A capsid protein, 5-Y719F-CD40L-M technology, applied in the field of biotechnology and medicine, can solve the problem of less than 15% survival rate, and achieve the goal of inhibiting the growth of lung cancer, improving gene transduction efficiency, and promoting cell apoptosis. Effect

Inactive Publication Date: 2014-10-08
JIANGSU PROVINCE HOSPITAL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some progress has been made in the early diagnosis and comprehensive treatment of lung cancer in recent years, 90% of lung cancers have metastasized when they are discovered, and the 5-year survival rate is less than 15%.
[0011] At present, there is no report at home and abroad which serotype of scAAV with a mutation in the tyrosine residue of the coat can efficiently transduce lung cancer cells, and there is no report on the construction of an adeno-associated virus vector with a membrane-stable CD40L gene and its application in anti-tumor gene therapy report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of double-strand recombinant adeno-associated virus mediating membrane-stabilized cd40l gene capsid protein mutation
  • Preparation method and application of double-strand recombinant adeno-associated virus mediating membrane-stabilized cd40l gene capsid protein mutation
  • Preparation method and application of double-strand recombinant adeno-associated virus mediating membrane-stabilized cd40l gene capsid protein mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Such as Figure 1A and Figure 1B , pcDNA3.1 + - CD40L-M construction and identification. The specific steps are: ①pcDNA3.1 + - CD40L plasmid construction and identification. Isolation of human mononuclear cells from peripheral blood; total cellular RNA extraction and cDNA transcription; RT-PCR amplification of the target gene CD40L (upstream primer: 5'-CCGGAATTCCCAGAAGATA-3', downstream primer: 5'CCGCTCGAGTCAGCTCCA-3', product size: 850bp); the target gene fragment and pcDNA3.1 were digested with restriction enzymes EcoRI and XhoI + Vector (purchased from Invitrogen) ligation; pcDNA3.1 + - CD40L plasmid transformation and characterization. ②pcDNA3.1 + - CD40L-M plasmid construction and identification. Clone pcDNA3.1 from source + -CD40L designed and synthesized primers to introduce variation points (Q 114 K 115 D. 117 Q 118 N 119 for P 114 R 115 E. 117 E. 118 D.119 ); the high-fidelity DNA polymerase platinum pfx DNA Polymerase (Invitrogen) was used fo...

Embodiment 2

[0061] Such as Figure 2A and 2B , pdsAAV-CB-CD40L-M plasmid construction and identification. The specific steps are: ① amplify pcDNA3.1 + -CD40L-M and pdsAAV-CB-GFP, primers are T7 and T405-R (T405-R: CTTAGGAGCTCGTCGACGTCGAGGCTGATCAGCGGGT), CD405-R primers added SacI restriction site and protective base; then double digestion with BamHI and SacI The PCR product was cloned into the target vector pdsAAV-CB-GFP; a single clone was selected for bacterial inspection, and the positive clone was sequenced to obtain a clone consistent with the standard sequence.

Embodiment 3

[0063] Such as Figure 3A , the base sequence of about 730 sites on the surface of the AAV shell of different serotypes and the construction of AAV2 / 5 mutation sites. Homologous alignment and crystal structure analysis of AAV2 and AAV2 / 5 genes confirmed that the amino acid at position 719 on the surface of AAV5 capsid protein corresponds to the tyrosine residue at position 730 of AAV2 capsid protein. Use Quik IISite-Directed Mutagenesis Kit (Alignment Technologies) standard point mutation kit. Synthesize the mutant strand first: denature the DNA template, anneal to the mutant primer containing the desired mutation, use Pfu DNA polymerase was used for primer extension to construct the pAAV2 / 5-Y719F-R / C plasmid with point mutation of tyrosine (Y) coding base at position 719 of AAV2 / 5 virus coat protein to phenylalanine (F) coding base (Primer AAV2 / 5-Y719-F: CCCATTGGCACCAGATTCCTGACGCGTAATCTGTAATTGCTTG, AAV2 / 5-Y719-R: CAAGCAATTACAGATTACGCGTCAGGAATCTGGTGCCAATGGG). DpnI digest...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleotide sequence and an amino acid sequence of a human derived membrane-stabilization mutant gene CD40L-M, and a plasmid carrier pdsAAV-CB-CD40L-M. The invention further discloses a recombinant adeno-associated virus scAAV2 / 5-Y719F-CD40L-M using CD40L-M as a target gene and highly-efficiently transducing lung cancer cells, a preparation method thereof, and an application thereof in preparing anti-cancer drugs. In vitro and in vivo tests of transduction of the CD40L-M gene into the lung cancer cells show that generation of the sCD40L is substantially reduced, a traditional AAV transduction efficiency is improved by using the recombinant adeno-associated virus scAAV2 / 5-Y719F-CD40L-M, the lung cancer cells can be highly-efficiently transduced, and the CD40L-M gene induces retardance of cell cycles, promotes cell apoptosis, induces immunization activation, inhibits growth of lung cancer in the body and reduces side effects such as liver and kidney damage.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and in particular relates to a double-chain recombinant adeno-associated virus vector mediating membrane-stabilized CD40L-M gene capsid protein mutation and its preparation method and application. Background technique [0002] Lung cancer is one of the malignant tumors with the highest mortality rate in China and even in the world. Although some progress has been made in the early diagnosis and comprehensive treatment of lung cancer in recent years, 90% of lung cancers have metastasized when they are discovered, and the 5-year survival rate is less than 15%. Therefore, there is an urgent need to find new ways to treat primary lung cancer and its metastases. [0003] At present, immune gene therapy is regarded as one of the most promising tumor treatment methods. Tumor immunity involves systemic immunity and local immunity, including complex processes. The tumor microenvironment (micr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/864C12N15/66C12N7/01A61K48/00A61P35/00C12R1/93
Inventor 吴剑卿赵卫红许伟
Owner JIANGSU PROVINCE HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More