Molecular marker related to micropterus salmoides hatchability and application thereof

A technology for largemouth bass and hatchability, which is applied in the field of animal genetic engineering, can solve the problems affecting the screening effect of parents with high hatchability of largemouth bass, and achieve the effects of improving relative hatchability, rapid detection, and simple operation

Inactive Publication Date: 2013-05-15
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no molecular markers associated with hatching of largemouth bass have been found, which affects the screening effect of high hatchability parents of largemouth bass

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to micropterus salmoides hatchability and application thereof
  • Molecular marker related to micropterus salmoides hatchability and application thereof
  • Molecular marker related to micropterus salmoides hatchability and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Screening of insertion / deletion sites

[0031] 1. Experimental fish

[0032] In November 2008, 170 largemouth bass samples were randomly collected from the breeding base of Jiujiang Town, Nanhai District, Foshan City, Guangdong Province for the screening of gene mutation sites and the correlation analysis of growth traits. The body weight, body length and body height of each largemouth bass were measured. At the same time, blood was collected from the tail vein. The ratio of anticoagulant (ACD) to blood volume was 6:1, and DNA was extracted with Blood&Cell Culture DNA Kit (Clontech).

[0033] 2. Amplification of the GHRH promoter sequence

[0034] The cDNA sequence of the growth hormone releasing hormone (GHRH) gene of largemouth bass (GenBank accession number: HQ640678) was compared with the complete sequence of the known fish GHRH gene, and primers P1 and P2 were designed (Table 1), Promoter for amplification of GHRH. According to the operation of t...

Embodiment 2

[0054] A method for assisting in screening high-hatchability largemouth bass parents, comprising the steps of:

[0055] 1. Design of primers

[0056] According to the flanking sequence of a 66 bp recessive lethal deletion mutation site on the promoter sequence of the growth hormone releasing hormone (GHRH) gene of largemouth bass, primers were designed and synthesized as follows (see figure 1 ):

[0057] P1: GGCCCGGGCTGGTCTGTTAAATACA (SEQ ID NO: 3)

[0058] P2: GCGCAACACAAGAGCACATTGCTT (SEQ ID NO: 4)

[0059] Individuals with AA genotype are expected to amplify 1 DNA band with a size of 316bp; individuals with AB genotype are expected to amplify 2 DNA bands with a size of 316bp and 250bp.

[0060] 2. Template DNA extraction and PCR amplification

[0061] (1) Take 3 mg of fin ray tissue of the broodstock to be tested and cut it into pieces, add 0.5 mL of lysate (10 mmol / L Tris-HCl; 0.1 mol / L EDTA; 0.5% SDS; 30 mg / L RNase; 100 mg / L protease K, pH8.0), digested at 55°C for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a molecular marker related to micropterus salmoides hatchability and an application thereof. The molecular marker related to micropterus salmoides hatchability is at the 97-163bp on GHRH (growth hormone releasing hormone) gene promoter sequence of the micropterus salmoides. A GHRH promoter gene with a 66bp sequence is named as A, and a deletion mutantion GHRH promoter gene is named as B. A primer is designed according to the GHRH promoter sequence of the micropterus salmoides, a parental genetype is identified through a molecular cone manner, a micropterus salmoides parent of AB genetype in production is removed, and a micropterus salmoides parent of AA genetype is maintained, so that the parental relative hatchability is improved. Compared with traditional molecular marker, the molecular marker has the advantages of strong purposiveness and direct action effect, is simple in operation, fast in detection, and low in detection cost, and can be widely promoted and used.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering. It specifically relates to a molecular marker related to the hatchability of largemouth bass and its application in assisting in the screening of largemouth bass parents with high hatchability. Background technique [0002] largemouth bass ( Micropterus salmoides ), commonly known as California perch, is native to the Mississippi River Basin in the United States. It is a wide-temperate fish. It has the characteristics of fast growth, few diseases, low temperature resistance, delicious meat and easy to catch. It is one of the important freshwater aquaculture economic species in my country. At present, the largemouth bass cultured in my country is domesticated from wild introduced species, and for more than 20 years of breeding, due to the lack of attention to the operating procedures that must be followed by the parental species, and the lack of directional artificial breeding,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 李胜杰白俊杰韩林强马冬梅叶星樊佳佳姜鹏全迎春于凌云
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap