Halobacillus kuroshimensis HSQAY1 with capacity of dissolving skeletonema costatum and application thereof

A technology of spore rod and rib, applied in the field of microorganisms

Inactive Publication Date: 2013-05-22
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] After retrieving patents and other relevant literature, no report has been found on the application of Halobacillus kuroshimensis HSQAY1 to dissolve the red tide algae—Sclerostena costatum under aerobic conditions; It is of great significance to develop and explore the effective methods of red tide control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Halobacillus kuroshimensis HSQAY1 with capacity of dissolving skeletonema costatum and application thereof
  • Halobacillus kuroshimensis HSQAY1 with capacity of dissolving skeletonema costatum and application thereof
  • Halobacillus kuroshimensis HSQAY1 with capacity of dissolving skeletonema costatum and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The screening method of Skeletalum costa marine algae-lytic bacteria in embodiment 1

[0021] 1. Isolation and purification of marine bacteria

[0022] The surface seawater samples were collected from the sea area where the red tide broke out in Nanao, Dapeng Bay, Shenzhen. After filtering with a 0.7 μm glass cellulose membrane, they were serially diluted and then coated with a bacterial isolation medium plate. They were cultured at a constant temperature of 28°C for 48 hours, and the colonies with obvious differences in characteristics were picked and marked. Incubate at a constant temperature of 28°C for 48h. Repeat the above operation twice to obtain purely cultured bacteria. The bacterial isolation medium used was 2216E agar medium, and its ingredients were: 5g of peptone, 1g of yeast extract, 0.1g of ferric phosphate, 20g of agar powder, 1000ml of aged seawater, pH 7.6-8.2.

[0023] 2. Screening of marine algae-lytic bacteria from Scleraceae costarum

[0024] Pi...

Embodiment 2

[0026] The phylogenetic tree of embodiment 2 Halobacillus kuroii HSQAY1

[0027] 1.16S rDNA gene sequence determination

[0028]Using UNIQ-10 Column Bacterial Genomic DNA Extraction Kit (Shanghai Sangon Bioengineering Co., Ltd.) to extract the DNA of Bacillus kuroii HSQAY1, after electrophoresis analysis of the genomic DNA, it was used as a template for PCR amplification. The added upstream primer was 27F: 5′-AGAGTTTGATCCTGGCTCAG-3′, and the downstream primer was 1492R: 5′-GGTTACCTTGTTACGACTT-3′. The reaction process included: pre-denaturation at 98°C for 5 minutes, denaturation at 95°C for 35S, annealing at 55°C for 35s, and 72 There were 35 cycles of extension at ℃ for 90 s, and the last cycle was maintained at 72 °C for 8 min to complete the extension of the product. After electrophoresis purification of the PCR product, its full sequence was determined. ATGCAAGTCGAGCGCGGGAAGCGAGTGGATCCCTTCGGGGTGAAGCTCGTGGAACGAGCG 60GCGGACGGGTGAGTAACACGTGGGCAACCTGCCTGTAAGATCGGAATAACCCCG...

Embodiment 3

[0031] Example 3 Colony Morphological, Physiological and Biochemical Characteristics of Halobacillus kuroshimensis HSQAY1 (Halobacillus kuroshimensis HSQAY1)

[0032] The colony of Halobacillus kuroshimensis HSQAY1 (Halobacillus kuroshimensis HSQAY1) was dark yellow, round, opaque, with neat edges, smooth and moist; the morphology of the bacteria was slightly short and thick bacilli, and the size was (0.6-1.2) μm×( 1.6~2.4) μm, with flagella, see cell morphology image 3 , the physiological and biochemical characteristics are shown in Table 1. Combined with the results of 16S rDNA sequence analysis of the bacteria, it was finally determined that HSQAY1 was a bacterium of the genus Halobacillus krusei.

[0033] Table 1 Physiological and biochemical characteristics of Halobacillus kuroshimensis HSQAY1

[0034]

[0035] Note: "+" means positive; "-" means negative

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses halobacillus kuroshimensis HSQAY1 which is collected in the China center for type culture collection on 12, June 2012 with the collection number of CCTCC NO: M2012221. The invention also discloses application of the strain in skeletonema costatum in the degradable red tide outbreak sea region. According to the strain, skeletonema costatum cells arranged in a chain shape can be broken, so that the cells are expanded into a ball shape and are finally broken to die; and moreover, the strain is autochthonous bacteria and is expected to exert important functions in biological treatment practice in red tide, and secondary pollution or alien invasive species and other pollution conditions are avoided in actual application.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain HSQAY1 of Halobacillus krusii and its application. Background technique [0002] Red tide disasters caused by water eutrophication and other reasons have serious impacts on aquatic ecosystems, aquaculture industry and human health, and have become one of the global environmental problems. The use of chemical agents such as copper sulfate can effectively inhibit and kill red tide algae, but it is easy to cause secondary pollution to the environment. Physical methods such as modified clay can be used to flocculate and settle red tide algae, but may have negative impacts on benthic organisms. The use of algicidal bacteria to inhibit or control red tide algae has the advantages of high efficiency, safety, reliability, and small negative impact on the environment, and has become a hot issue in the research of red tide prevention and control at home and abr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C02F3/34C12R1/01
CPCY02A90/40
Inventor黄洪辉史荣君齐占会胡维安
OwnerSOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI