Application of a diagnostic antigen for toxoplasma infection
A technology of toxoplasma and antigen, which is applied in the field of diagnostic antigen and preparation of toxoplasma infection, which can solve the problems of short antibody detection time and undetectable toxoplasma infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1. Screening and identification of diagnostic antigens for Toxoplasma gondii infection
[0053] 1.1 Amplification and purification of Toxoplasma gondii
[0054] Take Toxoplasma gondii RH strain about 5×10 6 Healthy clean ICR mice were injected intraperitoneally, and then killed by neck dislocation after 3 days of feeding. The peritoneal cavity of the mice was washed with sterilized normal saline, and lymphocytes containing Toxoplasma gondii tachyzoites were collected, and the tachyzoites were purified using lymphocyte separation medium to remove lymphocytes. cells for purification.
[0055] 1.2 Establishment of Toxoplasma gondii artificial infection model and serum collection
[0056] Buy 1-day-old chicks, and feed each chick at 10 7 Toxoplasma gondii JS strain was injected intraperitoneally, and serum was collected and separated at different times after challenge.
[0057] 1.3 Extraction and Western blot of whole tachyzoite protein
[0058] Centrifuge the ...
Embodiment 2
[0061] Example 2. Preparation of diagnostic antigen GRA8 for Toxoplasma gondii infection
[0062] 2.1 Synthetic primers
[0063] According to the Toxoplasma gondii GRA8 protein known in Example 1, the nucleotide sequence was retrieved from Genbank, the GRA8 primers P1 and P2 were designed using the software primer premier5.0, and sent to Shanghai Handsome Biotechnology Co., Ltd. to synthesize the primers. The sequence is as follows:
[0064] P1: 5'—CCG GAATTC ATGGCTTTACCATTGCGTGTT - 3' (SEQ ID NO: 2),
[0065] P2: 5'—CCC AAGCTT TTAATTCTGCGTCGTTACGGT - 3' (SEQ ID NO: 3).
[0066] The underlined parts are the introduced enzyme cutting sites Hind III and EcoRI, respectively; the boxed part is the initiation codon.
[0067] 2.2 Extraction of total RNA from Toxoplasma gondii
[0068] One-step method was used to extract total RNA of Toxoplasma gondii, and the specific operation steps were as follows: take 10 7 Put the purified Toxoplasma gondii tachyzoites in a DEPC-treated...
Embodiment 3
[0084] Example 3. Establishment and verification of diagnostic antigen GRA8-ELISA
[0085] 3.1 Basic experimental steps of indirect ELISA assay
[0086] 3.1.1 Coating: After diluting GRA8 recombinant protein with pH9.6 CBS buffer, coat the ELISA plate with 100 μL / well, 110ng / well protein amount at 4°C for 12 hours, dry the contents after 12 hours, pour into the wells Add washing liquid, let stand for 1min, spin dry and pat on the absorbent paper pad, add washing liquid, and wash repeatedly 3 times. The washed ELISA plate can be used immediately or sealed in a plastic bag with a sealing machine and stored at -20°C for short-term use.
[0087] 3.1.2 Blocking: After washing the ELISA 96-well plate to remove the residual unbound coating protein, add 200 μL of 5% skim milk blocking solution to each well, block at 37°C for 1 hour, add TBST to wash 5 times after the blocking is completed, and add the lotion to each well and then statically Set for 3min.
[0088] 3.1.3 Effect of pr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
