Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of a diagnostic antigen for toxoplasma infection

A technology of toxoplasma and antigen, which is applied in the field of diagnostic antigen and preparation of toxoplasma infection, which can solve the problems of short antibody detection time and undetectable toxoplasma infection

Active Publication Date: 2015-09-16
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the antibody diagnostic kits for Toxoplasma gondii infection on the domestic market have the problem that the antibody detection time is short and cannot be detected in the late stage of Toxoplasma gondii infection.
Since the choice of coating antigen is the key to determine the efficiency of ELISA detection, the formation of these problems is likely caused by the choice of coating antigen is not optimized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a diagnostic antigen for toxoplasma infection
  • Application of a diagnostic antigen for toxoplasma infection
  • Application of a diagnostic antigen for toxoplasma infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1. Screening and identification of diagnostic antigens for Toxoplasma gondii infection

[0053] 1.1 Amplification and purification of Toxoplasma gondii

[0054] Take Toxoplasma gondii RH strain about 5×10 6 Healthy clean ICR mice were injected intraperitoneally, and then killed by neck dislocation after 3 days of feeding. The peritoneal cavity of the mice was washed with sterilized normal saline, and lymphocytes containing Toxoplasma gondii tachyzoites were collected, and the tachyzoites were purified using lymphocyte separation medium to remove lymphocytes. cells for purification.

[0055] 1.2 Establishment of Toxoplasma gondii artificial infection model and serum collection

[0056] Buy 1-day-old chicks, and feed each chick at 10 7 Toxoplasma gondii JS strain was injected intraperitoneally, and serum was collected and separated at different times after challenge.

[0057] 1.3 Extraction and Western blot of whole tachyzoite protein

[0058] Centrifuge the ...

Embodiment 2

[0061] Example 2. Preparation of diagnostic antigen GRA8 for Toxoplasma gondii infection

[0062] 2.1 Synthetic primers

[0063] According to the Toxoplasma gondii GRA8 protein known in Example 1, the nucleotide sequence was retrieved from Genbank, the GRA8 primers P1 and P2 were designed using the software primer premier5.0, and sent to Shanghai Handsome Biotechnology Co., Ltd. to synthesize the primers. The sequence is as follows:

[0064] P1: 5'—CCG GAATTC ATGGCTTTACCATTGCGTGTT - 3' (SEQ ID NO: 2),

[0065] P2: 5'—CCC AAGCTT TTAATTCTGCGTCGTTACGGT - 3' (SEQ ID NO: 3).

[0066] The underlined parts are the introduced enzyme cutting sites Hind III and EcoRI, respectively; the boxed part is the initiation codon.

[0067] 2.2 Extraction of total RNA from Toxoplasma gondii

[0068] One-step method was used to extract total RNA of Toxoplasma gondii, and the specific operation steps were as follows: take 10 7 Put the purified Toxoplasma gondii tachyzoites in a DEPC-treated...

Embodiment 3

[0084] Example 3. Establishment and verification of diagnostic antigen GRA8-ELISA

[0085] 3.1 Basic experimental steps of indirect ELISA assay

[0086] 3.1.1 Coating: After diluting GRA8 recombinant protein with pH9.6 CBS buffer, coat the ELISA plate with 100 μL / well, 110ng / well protein amount at 4°C for 12 hours, dry the contents after 12 hours, pour into the wells Add washing liquid, let stand for 1min, spin dry and pat on the absorbent paper pad, add washing liquid, and wash repeatedly 3 times. The washed ELISA plate can be used immediately or sealed in a plastic bag with a sealing machine and stored at -20°C for short-term use.

[0087] 3.1.2 Blocking: After washing the ELISA 96-well plate to remove the residual unbound coating protein, add 200 μL of 5% skim milk blocking solution to each well, block at 37°C for 1 hour, add TBST to wash 5 times after the blocking is completed, and add the lotion to each well and then statically Set for 3min.

[0088] 3.1.3 Effect of pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a diagnosis antigen for Toxoplasma gondii infection and a preparation method and applications thereof, belonging to the technical field of biological veterinary drugs. An antigen GRA8 suitable for diagnosis for Toxoplasma gondii infection is screened out by using methods combining Western blot, two-dimensional electrophoresis, and MALDI-TOF-TOF tandem mass spectrometry. The antigen can be used for a variety of molecular biology diagnosis and serological diagnosis for the Toxoplasma gondii infection.

Description

technical field [0001] The invention relates to the technical field of biological veterinary medicine, and relates to a diagnostic antigen for toxoplasma gondii infection, a preparation method and application thereof. The diagnostic antigen is located on the dense granules of Toxoplasma gondii tachyzoites, a protein consisting of 267 amino acids, which is secreted to the edge of the parasitic vesicle during the process of Toxoplasma gondii invading cells and when Toxoplasma gondii has just completed its invasion. Background technique [0002] Toxoplasma gondii (Toxoplasma gondii) belongs to the phylum Protozoa, Apicomplexa, Sporozoa, Coccidia, Eucoccidia, Eimeria, Sarcocystinidae, Toxoplasma, in 1908 discovered and named. The life cycle of Toxoplasma gondii includes a sexual reproductive stage (coccidian-type life cycle) and an asexual reproductive stage. Toxoplasma gondii can only reproduce sexually in the intestinal epithelial cells of the final host, cats, but can repro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/45
Inventor 李祥瑞徐立新严若峰宋小凯李锐
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com