Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof
A technology of T7505C and mitochondria, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as troubles, achieve the effect of relieving pain, facilitating large-scale screening and preventive inspection, and simple detection process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 A kit of the present invention
[0038] see figure 1 , the kit provided by the present invention consists of DNA extraction mixture 1, PCR mixture 2 for amplifying T7505C fragments, a pair of outer primers 3 designed for T7505C, inner primers 4 designed for T7505C, restriction endonucleases 5, positive Control 6, negative control 7 and box body 8, wherein DNA extraction mixture 1 is mainly composed of cell lysate, proteinase K solution, chloroform, phenol, and absolute alcohol; PCR mixture 2 for amplifying the T7505C fragment includes dNTP (deoxymononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq Enzyme (DNA polymerase), outer forward primer F designed for T7505C: ACG CCA AAA TCC ATT TCA CT (SEQ ID NO:1), outer reverse primer R: CGG GAA TTG CAT CTG TTT TT (SEQ ID NO: 2); The inner primers designed for T7505C include inner forward primer F: TAGACAAAAAAGGAAGGAATCGAACCCCCAAAGCTGGTTTCAAAGCCAACCGCTTGGCCTCCA (SEQ ID NO: 3), inner reverse p...
Embodiment 2
[0040] Example 2 Carrying mitochondrial tRNA Ala Detection of deaf families with T7505C mutation
[0041] 1. Test samples
[0042] A deaf family carrying the T7505C mutation was selected. See his pedigree Figure 4 . This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 18, including 9 members of the maternal line and 7 people who are deaf.
[0043] 2. Extraction of Genomic DNA
[0044] Samples from 4 subjects were obtained respectively (including a drop of venous blood filter paper from the capillaries of Ⅰ-1 and Ⅲ-1; Ⅱ-1 was the oral mucosa scraping or saliva; Ⅱ-2 was the hair with hair follicles), and the Use clean scissors to cut the blood filter paper into pieces of paper about 1cm2 in size, put them into a 1.5ml EP tube (Eppendorf tube), add 900μl red blood cell ly...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 