Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof

A technology of T5655C and mitochondria, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as troubles, and achieve the effects of pain relief, low cost, and simple detection process

Active Publication Date: 2014-11-26
ZHEJIANG UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This blood collection method has brought some pain and injury to many subjects, especially infants and young children, and there are certain risks and troubles when transferring samples across regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof
  • Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof
  • Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 A kit of the present invention

[0039] see figure 1 , the kit provided by the present invention consists of (1) DNA extraction mixture, (2) PCR mixture for amplifying T5655C fragment, (3) a pair of outer primers designed for T5655C, (4) a pair of inner primers designed for T5655C Primers, (5) restriction endonucleases, positive control 6, negative control 7 and cassettes. Among them, the DNA extraction mixture is mainly composed of cell lysate and solution I; composition; the PCR mixture 2 for amplifying the T5655C fragment includes dNTP (deoxygenated mononucleotide), 10×PCR buffer, MgCl 2 , triple distilled water and Taq enzyme (DNA polymerase), a pair of outer primers 3 designed for T5655C have outer forward primer F: CTAACCGGCTTTTTGCCC (SEQ ID NO: 1) and outer reverse primer R: ACCTAGAAGGTTGCCTGGCT (SEQ ID NO: 2); designed for T5655C A pair of inner primers 4 has an inner forward primer F: AAGCCTAAGTAAGTTGC (SEQ ID NO:3) and an inner reverse primer...

Embodiment 2

[0041] Example 2 Carrying mitochondrial tRNA Ala Detection of essential hypertension families with T5655C mutation

[0042] 1. Test samples

[0043] see Figure 4 , A family with essential hypertension carrying the T5655C mutation was selected. This family showed typical maternal inheritance, and the only clinical symptom was elevated blood pressure in all patients, but the degree of elevated blood pressure of each affected member in the family varied. The total number of people in this family is 47, including 19 members of the maternal line, and 16 people suffering from high blood pressure.

[0044] 2. Extraction of Genomic DNA

[0045] Samples from 7 subjects were obtained respectively (including one drop of venous blood filter paper from capillaries collected from Ⅰ-2, Ⅱ-13 and Ⅱ-14; Ⅱ-1 and Ⅱ-2 were oral mucosa scrapings or saliva; Ⅱ-7 and Ⅱ-9 are hair with hair follicles), cut the blood filter paper into pieces with a size of about 1cm2 with clean scissors, put them ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting mitochondrial DNA T5655C mutation linked to primary hypertension. The kit is composed of DNA extraction mixed liquor, PCR mixed liquor, outer primers and inner primers specifically designed for T5655C, restriction endonuclease, a positive control, a negative control and a kit body. According to the invention, genomic DNAs are rapidly extracted from samples like a small amount of a blood specimen, hair with hair follicles, a mouth mucosa scraping smear and saliva by using a protease K digestion cleavage process, so problems in extraction of DNAs from blood of a patient with primary hypertension in the prior art are overcome, pains of a detected person are alleviated, and trans-regional sample transmission is realized; different sites formed by the specific restriction endonuclease enable specificity of enzyme digestion to be improved; molecular internal control indexes are set, so the phenomenon of false negative results is avoided and stability of detection results is improved; and the kit has the advantages of low detection cost, simple and fast detection flow, visually interpretable results and good practicality.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a kit for detecting the mitochondrial DNA T5655C mutation associated with essential hypertension, and also relates to a detection method for the mitochondrial gene mutation associated with essential hypertension, in particular to the detection of mitochondria tRNA Ala The method for the T5655C mutation, and the application of the above-mentioned method or the above-mentioned kit in detecting the mitochondrial DNA T5655C mutation related to essential hypertension. Background technique [0002] Cardiovascular disease is the leading cause of death worldwide, including a series of diseases involving the circulatory system (mainly the heart and blood vessels) such as coronary heart disease, hypertension, heart attack, stroke, cardiomyopathy and heart failure. According to the statistics of the World Health Organization (WHO), about 17.3 million people died of cardiovascular disease...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 管敏鑫蒋萍萍冀延春肖云郑静梁敏毛卓超黄杨熠艺
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com