Serratia marcescens ankyrin repeat and its application

A technology of Serratia marcescens and ankyrin, applied in the field of genetic engineering

Active Publication Date: 2015-09-30
ANHUI POLYTECHNIC UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no related research on the ankyrin repeat of Serratia marcescens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serratia marcescens ankyrin repeat and its application
  • Serratia marcescens ankyrin repeat and its application
  • Serratia marcescens ankyrin repeat and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Preparation of Serratia marcescens ankyrin repeat

[0027] Take out the Serratia marcescens PL-06 preserved in the refrigerator at 4°C, pick a single clone and inoculate it into LB liquid medium, culture it overnight at 37°C, 200r / min for 10-12 hours, observe under microscope and identify 16SrDNA, confirm The homology with the 16SrDNA of various Serratia marcescens published in GenBank is 99%, thus confirming that the strain is Serratia marcescens, the microscopic picture is as follows Figure 5 , the 16SrDNA sequence is as sequence 1 in the sequence listing, genbank accession number: JX138534.

[0028] According to the published Serratia marcescens ankyrin repeat subsequence (GenBank: AY091641.1) of the complete genome sequence, the upstream primer SF and the downstream primer SR were designed as reference:

[0029] Upstream primer SF: 5'- CATGCCATGGTA CCTGAAGGGCGTCGCTT -3'

[0030] Downstream primer SR: 5'- CCCCTCGAGA CTGCTGCGCGTAGTG -3'.

[0031] ...

Embodiment 2

[0044] The construction of embodiment 2 recombinant bacterial strain plaS-pET-28 / BL21 and its thalline growth situation

[0045] ① The product amplified in Example 1 Pla Gel recovery with restriction endonuclease Nco I. xho I double enzyme digestion of the above recovered product and pET-28a (+) plasmid vector, the enzyme digestion system is as follows:

[0046] DNA 10μL

[0047] Nco I 1 μL

[0048] xho I 1 μL

[0049] Buffer K 5μL

[0050] Sterilized double distilled water 33μL

[0051] Total volume 50 μL.

[0052] After mixing, incubate at 37°C for 2 hours. After the end, add 10 μL 6×Loading Buffer to each 50 μL reaction solution to terminate the reaction, recover the digested fragments (about 0.7 kb and 5.4 kb), and connect the two fragments with T4 DNA ligase. The reaction system is as follows:

[0053] PCR double digestion product 12μL

[0054] pET-28a (+) double digestion product 8μL

[0055]Ligase 2μL

[0056] 10×Ligase Buffer 5μL

[0057] Steriliz...

Embodiment 3

[0062] Embodiment 3 Construction of recombinant bacterial strains plaA-pET-28 / BL21 and plaA-plaS-pET-28 / BL21 and their cell growth

[0063] ① Using the above-mentioned Serratia marcescens PL-06 genome as a template, PCR amplification was performed to obtain the phospholipase A1 gene plaA (see sequence 4 in the sequence listing) and phospholipase A1 gene + ankyrin repeat subgene i.e. plaA-plaS (See Sequence 5 in the Sequence Listing), wherein the underlined part in Sequence 4 is plaA sequence and Pla The part of sequence cross-common, the part underlined in sequence 5 is Pla sequence;

[0064] Among them, PCR amplification plaA Primers when:

[0065] Upstream primer AF: CATGCCATGGGCAGTATGCCTTTAAGT,

[0066] Downstream primer AR: CCCCTCGAGAGGCATTGGCCTTCGCCTC.

[0067] The amplification conditions are as follows:

[0068] AF 1μL

[0069] AR 1 μL

[0070] 10× PCR Buffer 5μL

[0071] 10mmol / L dNTP 2μL

[0072] 25mmol / L MgCl 2 4μL

[0073] Taq DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a serratia marcescens anchorin duplicon and its use in host bacteria. The serratia marcescens anchorin duplicon has a sequence shown in the formula of SEQ ID NO: 2. The invention also provides an inhibition effect of the serratia marcescens anchorin duplicon in host bacteria. The invention also provides a use of the serratia marcescens anchorin duplicon in promotion of expression of phospholipase A1 in escherichia coli. The invention also provides a recombinant vector and a recombinant strain containing the serratia marcescens anchorin duplicon. An experiment proves that through the expression of the serratia marcescens anchorin duplicon, host bacteria can be inhibited obviously. The serratia marcescens anchorin duplicon can greatly promote high-activity expression of the phospholipase A1 in escherichia coli.

Description

Technical field [0001] The present invention is a genetic engineering technology field, and it involves an anchor protein repetition of a sticky Sallem. Background technique [0002] Anchor protein was first discovered in various nuclear creatures. It is a wide existence of receptor protein. The typical anchor protein includes four parts: an anchor protein repetitive domain.And C-end domain.Studies have shown that anchor protein repetitive sub -structures exist in various cells and tissues, and are generally believed that anchor protein duplicates participate in protein interactions.There are also a large number of anchor protein repeats in the nucleus, participating in the interaction between various molecules and molecules. In certain pathogenic bacteria such as Purakami Corps and Lixci, anchor protein repetition is also involved in the effect protein of the effect protein.secretion.There are also such anchor protein repeats in viscosthride, which is higher than that of the anc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/24C12N15/31C12N15/70C12N1/21C12R1/19C12R1/43
Inventor薛正莲苏燕南王洲马琦亚张爽陈环
OwnerANHUI POLYTECHNIC UNIV