11 results about "Phospholipase A1" patented technology

The invention discloses a phospholipase A1 mutant and application thereof. According to the invention, PLA1 is modified to obtain a PLA1 mutant, compared with wild PLA1, the PLA1 mutant has the advantages that the optimum temperature is kept unchanged, the PLA1 mutant has higher phospholipase A1 activity at 40-50 DEG C, the optimum pH is changed from 3 to 8, and the PLA1 mutant keeps high phospholipase activity at the pH of 3-9 and is higher than the phospholipase activity of the PLA1 wild type under the optimum condition; the pH (Potential of Hydrogen) adaptability range of the PLA1 is widened. Therefore, the PLA1 mutant disclosed by the invention has a better application prospect, better meets the requirement on enzyme performance in phospholipid processing, can be used for degumming grease and producing lysophosphatide, and is applied to the fields of biology, food, medicine, beauty, agriculture, industry and the like.

The invention provides a fluorenyl alcohol derivative which can be used as an antibiotic adjuvant with a broad-spectrum synergistic effect. According to the compound, bacteria outer membrane asymmetric protein MlaC and phospholipase A1 PldA are taken as targets, and a series of fluorenyl alcohol derivatives targeting the bacteria outer membrane asymmetric protein MlaC and phospholipase A1 PldA are obtained through screening. The preferable compound WTU-15 can improve the antibacterial activity of antibiotics such as polymyxin, cefepime, tetracycline and the like on negative bacteria such as sensitive and drug-resistant escherichia coli, salmonella, klebsiella pneumoniae, acinetobacter baumannii and the like, and can also improve the in-vivo treatment effect of cefepime on mice infected by the drug-resistant acinetobacter baumannii. And the visceral organs of the mice survived after administration have fewer bacteria, and the mice are better after being healed. Normal physiological and visceral organ functions of the mouse are not affected by single and continuous administration of the WTU-15.

The application belongs to the field of oil and fat biological refining, and particularly relates to an oil and fat degumming method based on a phospholipase micromotor reactor. The application discloses an enzymatic degumming method for edible vegetable oil, algal oil and animal oil and fat. In view of the pain points of low degumming efficiency, long time consumption, easy deactivation and difficult recovery of enzymes in the traditional enzymatic degumming method, a core-shell mesoporous silica microsphere is designed, an emulsion method is used to graft alkyl and alkyl amine on both sides of the microsphere respectively, a Janus carrier with asymmetric chemical environment is constructed, and phospholipase A1, A2, B or C is solidified by physical adsorption to prepare a phospholipase micromotor reactor. In the degumming process, the micromotor cooperates with the 'interface activation-strengthening mass transfer-dynamic self-cleaning' mechanism, realizes self-driven movement in the interface microscale range by virtue of the substrate concentration gradient, significantly improves the phospholipase enzyme activity and stability, and realizes efficient degumming of oil and fat. The method has high oil yield, green process and is suitable for industrial popularization.

The application discloses a preparation method and application of low-pain and low-sensitization bee venom active peptide. The method comprises the following steps: pretreating Apis cerana cerana bee venom, performing first-stage separation by using an ultrafiltration membrane with a molecular weight cut-off of 1-5 kDa, and collecting filtrate with a molecular weight lower than the cut-off; performing second-stage separation by using a gel filtration medium with a size exclusion limit of 500-1000 Da, removing small-molecule neurotransmitters and stimulating small molecules, collecting bee venom active peptide components with a range of 700-3000 Da, and obtaining the low-pain and low-sensitization bee venom active peptide through freeze drying. The method can simultaneously reduce the content of 5-hydroxytryptamine, histamine and other pain-related small molecules and phospholipase A1, hyaluronidase and other large-molecule potential sensitization proteins in the bee venom, and retain anti-inflammatory activity. The bee venom active peptide can be used for preparing anti-inflammatory preparations, low-stimulation bee venom active raw materials, external use repair preparations, tumor cell proliferation inhibitors or other bioactive peptide related products.

The application discloses a phospholipase A1 mutant and application thereof. In the application, the PLA1 mutant is obtained by modifying the PLA1, wherein compared with the wild-type PLA1, the optimal temperature of the PLA1 mutant remains unchanged, and the PLA1 mutant has higher phospholipase A1 activity between 40-50 DEG C; the optimal pH of the PLA1 mutant is changed from 3 to 8; the PLA1 mutant has high phospholipase activity at pH 3-9, and the phospholipase activity is higher than that of the wild-type PLA1 under the optimal condition; and the pH adaptability range of the PLA1 is widened. Therefore, the PLA1 mutant has better application prospect, and meets the requirement of the enzyme performance in phospholipid processing, and can be applied to oil degumming, production of lysophosphatidylcholine, and application in the fields of biology, food, medicine, beauty, agriculture and industry.

The invention discloses an immobilized enzyme material, a preparation method and application of the immobilized enzyme material in phospholipid DHA synthesis. The immobilized enzyme material is composed of a magnetic MnFe2O4 nanometer core and an outer layer Ni3 (BTC) 2 metal organic framework, phospholipase A1 is loaded on a porous structure and a metal coordination site of Ni3 (BTC) 2, and the magnetically separable immobilized enzyme composite material is formed. The phospholipase A1 is efficiently immobilized through physical adsorption and metal coordination, the obtained immobilized enzyme material shows remarkable catalytic performance in a non-aqueous system, and compared with free enzyme, the apparent Km of the immobilized enzyme is reduced, the Vmax is increased, and the substrate affinity and the catalytic efficiency are remarkably improved. The material can be subjected to rapid magnetic separation and still keeps the relative activity exceeding 57.7% after being repeatedly used for five times, and the DHA doping rate of the immobilized enzyme can reach 54.37% in the directional acylation reaction of phospholipid DHA.

The invention belongs to the technical field of enrichment of specific fatty acids in oil through an enzyme method, and particularly relates to a method for enriching EPA and DHA in fish oil through an enzyme exchange reaction. The preparation method comprises the following steps: carrying out silica gel pretreatment on ethyl ester type fish oil to remove impurities, then mixing the ethyl ester type fish oil with high-purity lecithin, and carrying out synergistic catalytic reaction by utilizing phospholipase A1 and A2 and lipase under ultrasonic enhancement and nitrogen protection to selectively esterify EPA and DHA to sn-1 and sn-2 sites of phospholipid molecules, so as to obtain the high-purity lecithin. And finally, carrying out molecular distillation to obtain a high-purity structured phospholipid product. Results of embodiments show that the process can significantly improve the product quality, the phospholipid purity reaches 83-89%, the total Omega-3 doping rate is 35-48%, the process is far superior to a traditional solvent process, and the process has the comprehensive advantages of short reaction time, high product purity, no solvent residue and high bioavailability.

The invention provides a compound enzyme preparation and application thereof in preparation of a cyperus esculentus beverage, the compound enzyme preparation comprises phospholipase A1, a compound enzyme A, a compound enzyme B, tannase and carboxypeptidase, the compound enzyme A comprises cellulase, pectinase, alpha-amylase and beta-glucosidase; the compound enzyme B comprises neutral protease and alkaline protease. According to the particularity of components of the cyperus esculentus, main components of the cyperus esculentus comprise a certain amount of phospholipid and tannin besides fat, starch, dietary fiber and protein, although the contents of the components are relatively low, the taste of the finished product can be influenced by the existence of the components, so that the beany flavor and bitter taste of the finished product are caused; and the taste of the beverage is greatly improved.

The invention discloses a phospholipase A1 gene and application thereof, and relates to the technical field of bioengineering, and the key points of the technical scheme are as follows: the nucleotide sequence of the phospholipase A1 gene is as shown in SEQ ID No.1; a specific primer for expanding the gene of the phospholipase A1 is F-pPink: CGAGAAAGGCCTATGTTTCTTGGCTAGATT, and a specific primer for expanding the gene of the phospholipase A1 is F-pPink: CGAGAAAGGCCTATGCTGCTAGATT; r-pPink: GTAGTAGTAGTGATTCCATGGCCGGCCGGTA, and R-pPink:

This invention discloses a phospholipase A1 mutant and its applications, belonging to the fields of biotechnology and enzyme engineering. The mutant is obtained by site-directed mutagenesis of phospholipase A1-MFI, selected from any one of W166V, W166L, A116F, or L170H. Enzymatic property tests show that the mutant exhibits high hydrolytic activity under conditions of pH 8-10 and temperature 20-35℃. Compared with the wild type, the mutant shows significantly improved specific enzyme activity, PC hydrolysis rate, and LPC yield. This invention also discloses the nucleotide molecule encoding the mutant, the recombinant vector, the host cell, and its application in the preparation of lysophospholipids from hydrolyzed phospholipids. The phospholipase A1 mutant of this invention exhibits excellent catalytic performance and is suitable for use in food, pharmaceutical, and feed industries.

The invention discloses a construction method and application of a streptomyces mobaraensis engineering strain for producing phospholipase A1, and belongs to the technical field of enzyme engineering and food processing. The invention provides a streptomyces mobaraensis engineering bacterium for efficiently synthesizing phospholipase A1. On the basis of streptomyces mobaraensis smYS1-deltaG11-deltaG8-deltatg, a phospholipase A1 coding gene after codon optimization is subjected to heterologous expression. The invention also discloses enzyme production by fermentation of the engineering bacterium, enzymatic properties of the purified saPLA1 and application of the saPLA1 in degumming of crude soybean oil. According to the recombinant saPLA1, the phosphorus content of the soybean crude oil can be reduced from 113.01 mg / kg to 7.36 mg / kg or below. The food-grade expression system constructed by the invention has the advantages of high safety, high expression quantity, low production cost and the like, the degumming efficiency of the produced saPLA1 is high, and a new scheme is provided for industrial production of food-grade PLA1 and realization of efficient oil degumming.