Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method used for screening polypeptide in vitro

An in vitro screening and ribosome technology, applied in the field of chemical biology, can solve the problems that RNA-polypeptide fusions are difficult to withstand screening requirements, are susceptible to RNase, and affect the screening process. High stability effect

Active Publication Date: 2013-11-06
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this context, L.C. Mattheakis of the Afflymax Institute in the United States and J.W. Szostak of Harvard Medical School successively proposed two screening methods based on in vitro cell-free expression systems, ribosome display and mRNA display. As a template, the formed RNA-polypeptide fusion is difficult to withstand the stringent screening requirements, especially vulnerable to degradation by RNase, thus affecting the entire screening process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method used for screening polypeptide in vitro
  • Method used for screening polypeptide in vitro
  • Method used for screening polypeptide in vitro

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, in vitro screening polypeptide

[0039] For the procedure of screening peptides in vitro, see figure 1 .

[0040] (1) Construction of a double-stranded DNA library containing random sequences. Synthesize a single-stranded DNA library with random sequences by chemical methods, add equal concentrations of downstream primers for two cycles of PCR amplification, and finally obtain T7 promoters, enhancers, start codons, random sequences, and affinity purification Double-stranded DNA random library of tag-encoding sequences.

[0041] Single-stranded DNA random sequence:

[0042] TAATACGACTCACTATAGGAGGACGAAATG(NNN)9CACCACCACCATCATCATCAGC TGCGTAACTC

[0043] Downstream primer: GAG TTA CGC AGC TGA TGA

[0044] Reaction system and PCR conditions:

[0045]

[0046] The PCR conditions are: preheating at 95°C for 1min; denaturation at 95°C for 30s, renaturation at 45°C for 45s, extension at 72°C for 45s, 2 cycles.

[0047] (2) In vitro transcription. Using d...

Embodiment 2

[0060] Embodiment 2, the chemical modification of puromycin

[0061] The final product obtained by chemical modification of puromycin see figure 2 . The specific operation steps are as follows: a. Dissolve 100mg of puromycin in CH 3 CN (2ml), stirred at 0°C, added Et 3 N (60ul), the solution was clear, Fmoc-oSu (72mg) was dissolved in CH 3 CN (1ml) was added dropwise to the reaction solution at 0°C, and continued to stir. It turned into a white turbid liquid after 30 minutes. The reaction time was about 2h at 0°C and 1h at RT. After the reaction, the white solid product P1 was recovered by filtration through a funnel. b. Dissolve 150mg of P1 in 2ml of pyridine, stir well, add 200ul triethylamine, and stir at 0°C; dissolve 400mg of DMTrCl in 2ml of pyridine, inject it into the reaction solution with a needle, stir at 0°C to room temperature, and The column recovers product P2. c. Dissolve 420mg of P2 in 6ml of pyridine, add 10mg of DMAP, cool in an ice-water bath to 0°C, ...

Embodiment 3

[0062] Example 3. The modified puromycin is connected to a DNA with a fixed sequence. The reaction steps are basically the same as the widely used solid-phase phosphoramidite triester method, and the coupling product is obtained by high-performance liquid phase separation and purification. Such as image 3 As shown, Spacer18 near the 5' end of DNA represents polyethylene glycol with 12 carbons, and rC represents the base reversed in the 5'-3' direction on the oligonucleotide chain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of chemical biology technology, and discloses a method used for screening polypeptide in vitro. In order to break the limitation of existing polypeptide intracellular screening technology, the method comprises following steps: a random dsDNA library is constructed, and is transcribed to form mRNA; the mRNA and an oligonucleotide chain are subjected to anneal for complementation, and then in vitro expression is performed by taking the mRNA as a template, wherein the end of the oligonucleotide chain is connected with puromycin; when the expression is about to be completed, puromycin is delivered into a ribosome, a newly generated polypeptide chain is captured by puromycin and a covalent structure is formed; a random library is produced by inverse transcription, wherein in the random library, polypeptide and encoding information cDNA of the polypeptide are combined correspondingly; after screening, a primer is designed so as to subject the obtained cDNA to PCR amplification; and then a next circle of screening is performed so as to obtain the target polypeptide and encoding information of the target polypeptide after a plurality of screening cycles. The screening technologies employed in the method are in vitro, library capacity can reach 1013 to 1015, the system is stable, operation is simple, and screening efficiency is high.

Description

technical field [0001] The invention belongs to the technical field of chemical biology and relates to in vitro screening of polypeptides, in particular to constructing a cDNA-polypeptide library and using the established method to perform in vitro screening of specific target polypeptides. Background technique [0002] According to Darwin's evolution theory, the selection and evolution of biological macromolecules in nature follow the principle of "survival of the fittest, natural selection", but this process often takes tens of thousands of years, or even longer. How to simulate the evolution process of biological macromolecules in the laboratory and quickly produce molecules with specific activities has always been a dream of scientists. [0003] In the 1980s, G.P.Smith of the University of Missouri-Columbia established for the first time a display technology capable of conducting polypeptide molecular selection and evolution research in test tubes, that is, phage display...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B50/06C40B40/06C12Q1/68
Inventor 唐卓陈浩东
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com