Check patentability & draft patents in minutes with Patsnap Eureka AI!

Gene polymorphic marker of C-type lectin of portunus trituberculatus and genetic typing method of SNP (Single Nucleotide Polymorphism) molecular markers

A technology of portunus trituberculatus and gene polymorphism, applied in the direction of biochemical equipment and methods, DNA preparation, recombinant DNA technology, etc., to achieve the effect of low cost and short cycle

Active Publication Date: 2013-11-13
ZHEJIANG INST OF FRESH WATER FISHERIES
View PDF0 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Because HRM technology has many advantages, it is widely used in medical molecular typing diagnosis and methylation research. In recent years, it has also been gradually used in the field of aquatic biotechnology and molecular breeding. Report on Genotyping of SNP Molecular Markers in Portunus trituberculatus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene polymorphic marker of C-type lectin of portunus trituberculatus and genetic typing method of SNP (Single Nucleotide Polymorphism) molecular markers
  • Gene polymorphic marker of C-type lectin of portunus trituberculatus and genetic typing method of SNP (Single Nucleotide Polymorphism) molecular markers
  • Gene polymorphic marker of C-type lectin of portunus trituberculatus and genetic typing method of SNP (Single Nucleotide Polymorphism) molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] The following methods were used to obtain C-type lectin genomic DNA and molecular markers related to disease resistance of Portunus trituberculatus:

[0039] (1) Cloning of the full-length C-lectin DNA gene: According to the known mRNA sequence of the C-type lectin gene of Portunus trituberculatus (sequence number EU477491.1), primers were designed using Primer5.0 software, F1: 5'TCCTGTTCTGACAACCACCAA3' , R1: 5'CTGTGCCCGAGTCAAGAAGTA3', using the TIANampGenomic DNA purification kit to extract the total genomic DNA in the blood sample of Portunus trituberculatus, using this as a template, using long-fragment PCR to amplify the genomic DNA to obtain a sequence, clone it into a T vector and sequence it, Obtain the full length of the C-type lectin genome of 1473bp, including four exons and 3 introns, its DNA sequence is as described in the sequence table SEQ ID NO: 1, and the exon part is as follows figure 1 Shown in the framed part;

[0040] (2) Preparation of disease-resi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene polymorphic marker of C-type lectin of portunus trituberculatus. The gene polymorphic marker comprises four SNP (Single Nucleotide Polymorphism) sites of a gene sequence of the C-type lectin of portunus trituberculatus and deficiency of a triplet-base. SNP at 205bp of a fourth exon is associated with susceptibility / resistance of vibrio alginolyticus of portunus trituberculatus, and is named as T / C E4-205. The invention correspondingly discloses a method for obtaining a molecular marker of the C-type lectin associated with anti-vibrio alginolyticus of portunus trituberculatus and a method for association analysis. According to the invention, the molecular markers associated with diseases are obtained through modern molecular biological techniques and a method for quickly identifying SNP is established. The method has the advantages of high throughput, low cost, sensitivity and high specificity, truly realizes closed tube operation, can be used for selecting advantageous genotype individuals as parents by marker assisted selection (MAS), and lays an important foundation for culturing disease-resistant strains of portunus trituberculatus.

Description

technical field [0001] The invention relates to the preparation of the C-type lectin genome of Portunus trituberculatus and its SNP molecular markers related to resistance to Vibrio alginolyticus, and a method for rapidly performing SNP genotyping, and belongs to the technical field of molecular marker breeding in aquatic biology technology. Background technique [0002] Swimming crab (Portunus trituberculatus) is the leading product of mariculture in the coastal provinces of the mainland, especially in Zhejiang. Two-thirds of the portunus cultured in my country are in Zhejiang. In the "Twelfth Five-Year Plan", portunus trituberculatus is listed as one of the three leading products of aquaculture in Ningbo. However, in recent years, due to the continuous expansion of the breeding scale and the pollution of the breeding environment, the immune defense system of Portunus trituberculatus has been damaged, resulting in a decrease in its own disease resistance, an increase in sus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
CPCY02A50/30
Inventor 郝贵杰王春琳沈锦玉母昌考潘晓艺林锋李荣华盛鹏程姚嘉赟徐洋
Owner ZHEJIANG INST OF FRESH WATER FISHERIES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com