Method for detecting quantity of pseudomonas fluorescent in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction)

A technology of Pseudomonas fluorescens and transgenic wheat, applied in fluorescence/phosphorescence, biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as no revelation, and achieve simple identification methods and high amplification efficiency , good specific effect

Active Publication Date: 2015-03-04
JIANGSU ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no suggestion whether it can be used to detect bacteria in the rhizosphere soil during the growth period of transgenic wheat, and there are no relevant reports in previous public reports and papers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting quantity of pseudomonas fluorescent in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Method for detecting quantity of pseudomonas fluorescent in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Method for detecting quantity of pseudomonas fluorescent in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: The establishment of fluorescent quantitative PCR system

[0027] (1) Preparation of Pseudomonas fluorescens DNA template required for making a standard curve

[0028] According to Pseudomonas fluorescens gyrB Gene and fluorescent quantitative PCR primers require primer design:

[0029] SEQ ID No. 1: gyrB-F: TGTTCGAGGTGGTCGACAACT

[0030] SEQ ID No.2: gyrB-R: TGGAGGACGGTCATGATGA

[0031] Use this primer to amplify the target fragment from the extracted soil total DNA. The PCR reaction body is 25 μL, including 0.125 μL of rTaq enzyme, 2.5 μL of 10×PCR buffer, 2 μL of dNTP, 1.5 μL of Mgcl, 1 μL of upstream and downstream primers (10 μmol / L), 1 μL of template, and deionized water to make up the volume. The reaction conditions are: pre-denaturation at 94°C; denaturation at 94°C, annealing at 55°C, extension at 72°C, 35 cycles; agarose gel electrophoresis after 10 minutes of extension to confirm whether the PCR product is single and specific, and if the...

Embodiment 2

[0042] Embodiment 2: Sensitivity detection of fluorescent quantitative PCR detection system

[0043] The constructed standard plasmid was diluted 10 times to 2.57×10 10 Copies / μL~2.57×10 copies / μL, use the corresponding primers for fluorescent quantitative amplification to test the sensitivity of the amplification. Amplification curves were obtained (see attached Figure 4 ), and the amplification results were detected by agarose gel electrophoresis (see attached Figure 5 )

[0044] From the analysis of the above results, it can be known that after carrying out 10 times to the standard plasmid -7 Before double dilution, the amplification curve still showed an "s" shape, and the amplification curve was evenly spaced, and it also showed a clear gradient and better brightness after agarose gel electrophoresis. -7 After dilution, the "s" type of the amplification curve is not obvious, and the gradient cannot be distinguished. At this time, the sensitivity decreases, which is...

Embodiment 3

[0046] Analysis on the growth dynamics of Pseudomonas fluorescens in the rhizosphere soil during the main growth period of transgenic wheat

[0047] Adopt the fluorescent quantitative PCR system of embodiment 1

[0048] The real-time fluorescent quantitative PCR instrument was carried out by Rotor Gene 6000 fluorescent quantitative PCR produced by Corbett Company (Australia).

[0049] Collect wheat rhizosphere soil at the same place at the sowing stage, jointing stage, filling stage and maturity stage of winter wheat growth respectively, extract DNA, use the specific primers and amplification system provided in Example 1 to amplify, and calculate according to the standard curve Obtain the initial Pseudomonas fluorescens count in the soil sample.

[0050] The number of Pseudomonas fluorescens in the rhizosphere soil of wheat throughout the growth period was detected using the established Real-Time QPCR (see appendix Image 6 ). 2012 turn WYMV-Nib8 The copy number of Pseudo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The influence of transgenic crops on rhizospheric microorganisms in soil is an important aspect in environmental biosafety research. The invention establishes a detection system of Real-Time QPCR (Real-Time Fluorescent Quantitative Polymerase Chain Reaction)) by carrying out absolute quantification on the quantity of pseudomonas fluorescens in rhizospheric soil during the growth period of transgenic disease-resistant wheat. By virtue of application of the reaction system, the absolute quantification is carried out on the copy number of the pseudomonas fluorescens in the rhizospheric soil during the whole growth period of the transgenic wheat. A result shows that the designed primer has better specificity; the intervals of cycle thresholds (Ct values) of plasmids with various gradient standards in an amplification curve of Real-Time QPCR are uniform, the peak value of a melting curve is more obvious, and for the standard curve, the correlation coefficient R2 is equal to 0.99905, the slope is minus 3.203, and the amplification efficiency E is equal to 100%. In the seeding stage, seedling establishment stage, watery stage and mature stage of the transgenic wheat, the quantity of the pseudomonas fluorescens in the rhizospheric soil takes on a trend of gradually rising.

Description

technical field [0001] The invention relates to molecular detection technology of crop biocontrol bacteria and belongs to the field of biotechnology. Background technique [0002] According to the data of the Agricultural Biotechnology Application Service (ISAAA), by 2012, the number of countries planting genetically modified crops had reached 29, and the global area of ​​genetically modified crops had reached 1.5 billion hectares. . The increasing planting area of ​​genetically modified crops is mainly due to the huge economic benefits they bring, but whether such a large-scale expansion will have an impact on the entire agricultural planting environment has become an imminent question, so for its impact on the ecological environment of agricultural production Consideration is even more important. [0003] Pseudomonas fluorescens (Pseudomonas fluorescens) taxonomically belongs to the bacterial domain, Proteobacteria, γ-Proteobacteria, Pseudomonas orders, Pseudomonas genus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor史建荣杜鹃吴季荣刘馨徐剑宏胡晓丹
OwnerJIANGSU ACAD OF AGRI SCI