Unlock instant, AI-driven research and patent intelligence for your innovation.

Inducible-expression shuttle expression tool vector for borrelia and construction method and application thereof

A technology of borrelia and construction method, applied in the field of medical microbiology, can solve problems such as unfavorable research on borrelia

Active Publication Date: 2015-05-13
WENZHOU MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the field of pathogenic microbiology, the shuttle expression vector system and gene induction-expression system have always been one of the most commonly used technical means. In the genetic operating system of Borrelia, there is still only one Escherichia coli-Borrelia shuttle expression vector system. , whose replicon is derived from the circular plasmid cp9 (P.E.Stewart, R.Thalken, J.L.Bono, et al., Isolation of a circular plasma region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi.MolMicrobiol, 2001,39:714-721.), but there is no general tool expression vector for Borrelia at present, which is not conducive to the development of Borrelia research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible-expression shuttle expression tool vector for borrelia and construction method and application thereof
  • Inducible-expression shuttle expression tool vector for borrelia and construction method and application thereof
  • Inducible-expression shuttle expression tool vector for borrelia and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Synthesis of Partial Double Strands and Construction of Inducible Borrelia Shuttle Expression Tool Vector

[0044] Four single-stranded nucleotide DNA fragments (Invitrogen Company) were designed respectively, and the sequences were:

[0045] FLAG-HA-Tag1: TA TGGATTATAAAGATGATGATGATAAAGCCATGGCTGCAGA GCTC GTCGACCG;

[0046] FLAG-HA-Tag2: GAGCTCTGCAGCCATGGCTTTTATCATCATCATCTTTTATAATCC A ;

[0047] FLAG-HA-Tag3: CGGCGGCCGCCTCGAGTATCCTTATGATGTACCTGATTATGCT TA ;

[0048] FLAG-HA-Tag4: AGCT TAAGCATAATCAGGTACATCATAAGGATACTCGAGGCG GCCGCCG CGGTCGAC;

[0049] Among them, tag1 and tag2, tag3 and tag4 contain complementary sequences (underlined), the ends of tag1 and tag4 are complementary, and the 5' ends of tag1 and tag4 are phosphorylated.

[0050] Dissolve 4 synthetic DNA fragments (1 μg solid powder, Invitrogen, USA) to 50 μM in distilled water, mix in equal volumes, act at 95°C for 10 minutes, then gradually cool to 25°C and place for 12 hours to anneal and ge...

Embodiment 2

[0058] Construction of rpoS-induced expression strains

[0059] In order to verify that the constructed shuttle plasmid can replicate in Borrelia and has a controllable inducible expression element, this study selected the rpoS gene of Borrelia as an example, and used the constructed shuttle plasmid to induce the expression of rpoS gene in Borrelia. In Borrelia, the protein encoded by the rpoS gene, RpoS, is a sigma factor responsible for initiating the expression of the ospC gene, which encodes the membrane protein OspC, a virulence factor involved in Borrelia pathogenicity.

[0060] The rpoS gene of Borrelia B31 strain (GenBankID: 1195628) was amplified by PCR. The amplification primers were: upstream primer, GAGCTCCATATGAACATATTTAGTAATGAGG; downstream primer, AAGCTACTCGAGAT TTATTTCTTCTTTTAATTTTTAA. The amplification conditions are: 94°C for 5 minutes; 94°C for 25 seconds, 68°C for 1 minute, 30 cycles; 72°C for 10 minutes. After the PCR product was recovered from the gel, i...

Embodiment 3

[0063] Induced expression and functional verification of RpoS

[0064] Inoculate knockout bacteria ΔrpoS and strain ΔrpoS[pJJ275-RpoS HA ] into fresh BSK-H medium (Sigma, USA), cultivated to the logarithmic growth phase, counted by dark field microscope, and determined that the concentration reached 10 7 cell ml -1 , adding 1 mM IPTG and inducing at 37°C for 9 hours, while taking the sample without adding IPTG as a control. After induction, the cells were collected by centrifugation, a part was used for SDS-PAGE and Western blot analysis, and the other part was used for preparing RNA for reverse transcription and real time PCR analysis.

[0065] The method of real-time fluorescent quantitative PCR (Real time PCR, RT-PCR) is as follows, referring to the Qiagen RNA extraction kit (Qiagen, USA) instructions, take 10 Borrelia cells 8 Extract total RNA, remove residual DNA after DNAase treatment, and take 1g of RNA for reverse transcription. The reverse transcription method was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an inducible-expression shuttle expression tool vector for borrelia and application thereof. The sequence of the shuttle expression tool vector is shown in SEQ ID NO.1. The obtained shuttle expression tool vector contains the following components: (1) a replicon capable of replicating in Escherichia coli; (2) a replicon capable of replicating in borrelia; (3) a streptomycin resistance gene (aadA) controlled by a strong promoter flaB of borrelia and used for vector screening; (3) a coding region of repressor protein (LacI) and a promoter of repressor protein (LacI); (4) a binding site LacO of repressor protein; (5) polyclone sites inserted by using exogenous genes; and (6) a N-terminal fused FLAG tag and (or) a C-terminal fused HA tag. The vector can controllably express target genes in borrelia, so that the development of scientific research on borrelia is facilitated. The vector can be directly applied to gene function related researches on spirochetes by scientific researchers of the field, so that research process is accelerated.

Description

technical field [0001] The present invention relates to the field of medical microbiology, and more specifically relates to an inducible expression Borrelia shuttle expression tool vector, and also relates to a construction method of the vector, and also relates to the application of the vector in the study of Borrelia gene function. Background technique [0002] Borrelia is a Gram-negative bacterium. This genus of microorganisms has 5-10 sparse and irregular helices. It is active in movement, easy to color, microaerophilic, and its optimum temperature is 28-37 degrees. It is difficult to cultivate artificially. The genus includes several human pathogens, such as Borrelia burgdorferi, which causes Lyme disease and is transmitted to humans by ticks. The infection of Borrelia burgdorferi affects multiple systems of the human body. After different clinical stages, the affected organs will have long-term dysfunction; Borrelia burgdorferi that causes relapsing fever in humans, ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/74C12N15/66
Inventor 叶美萍楼永良
Owner WENZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More