Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application

A technology for recombining engineering bacteria and industrial wastewater, applied in the field of genetic engineering, can solve problems such as human harm, and achieve the effects of improving mercury tolerance and increasing cellular mercury accumulation

Inactive Publication Date: 2014-01-22
舒海燕 +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But this is not the fundamental solution to the problem, because the zero-valent mercury volatilized into the air will re-enter the mercury cycle and continue to cause harm to the human body

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application
  • Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application
  • Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] According to the plasmids pmr26 (GenBank accession number: D83080.2) and pmr28 (GenBank accession number: AB013925.1) of Pseudomonas K-62 strain, TAKARA Company was commissioned to synthesize the artificial operon merT-merP-merB1-merB2, using Nde I Plasmid pET28a (purchased from Shanghai Beinuo Biotechnology Co., Ltd.) was digested with Not I, and then recovered; the artificial operon merT-merP-merB1-merB2 was inserted using the In-Fusion HD Cloning Kit (Clontech, catalog number: 639633) To the region between Nde I and Not I of plasmid pET28a (purchased from Shanghai Beinuo Biotechnology Co., Ltd.), the specific operation process can be found in the In-Fusion HD Cloning Kit User Manual (Clontech, Protocol number: PT5162-1), and the ligation product Escherichia coli DH5a was transformed, and positive clones resistant to kanamycin were screened and cultured overnight, the plasmid was extracted, and the plasmid with the expected results of enzyme digestion and sequencing id...

Embodiment 2

[0051] Enterobacter aerogenes (Enterobacter aerogenes) (purchased from Shanghai Beinuo Biotechnology Co., Ltd.) was cultured in ordinary LB medium, and the culture conditions were 37°C and 180rpm shaking culture for 72h.

[0052] According to the ppk gene sequence of Enterobacter aerogenes (GenBank accession number: D14445.1), primers were designed to extract the genomic DNA of Enterobacter aerogenes. For details, please refer to the instructions of the Genomic DNA Extraction Kit of Enterobacter aerogenes (Cat. No.: DP302- 02). Using Enterobacter aerogenes genomic DNA as a template, the ppk gene was amplified. Primers are as follows:

[0053] PPPKF: 5'-ATAAGAAT GCGGCCGC ATTTACCACGTCCTGTGATT-3' (Underlined Not I restriction site)

[0054] PPPKR: 5'-CCGATCCG CTCGAG GGTTAATCGGGTTGCTCGAG-3' (underlined is the Xho I restriction site)

[0055] PCR reaction system: 2×Pfu MasterMix (Beijing Kangwei Century Biotechnology Co., Ltd., product number: CW0686A) 25μl, primer PPPKF 1pm...

Embodiment 3

[0059] According to the tobacco chloroplast genomic DNA sequence (GenBank accession number: Z00044.2) and the 5'UTR sequence of Escherichia coli T7 phage gene 10 (Olins and Rangwala. A novel sequence element derived from bacteriophage T7 mRNA acts as an enhancer of translation of the lacZ gene in Escherichia coli.The Journal of Biological Chemistry, 1989, 264(29):16973-16976), commissioned TAKARA company to synthesize primers,

[0060] P1F: 5'-CGA CATATG GCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCAGGGATGGCTATATTTCTGGGAGCGAACTCCGGGCGAATACGAAGCGCTTGGATACAGTTGTAGGGAGGGATTTATCTTTTAACTTTAAGAAGGAG TGGCCA AGCGCTATTCGATC GAATTC GGAC-3' (The italic letters indicate the UTR sequence at the 5' end of E. coli T7 phage gene 10; the underlines indicate the restriction sites of Nde I, Bal I and Eco RI)

[0061] P1R: 5'-GTCC GAATTC GATCGAATAGCGCT TGGCCA CTCCTTCTTAAAGTTAAAAGATAAATCCCTCCCTACAACTGTATCCAAGCGCTTCGTATTCGCCCGGAGTTCGCTCCCAGAAATATAGCCATCCCTGCCCCCTCACGTCAATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant plasmid for eliminating industrial wastewater mercury pollution, a construction method, a recombinant engineering bacterium and an application. The recombinant plasmid is established by inserting tobacco chloroplast rrn16 gene strong promoter, ribosome binding site conserved sequence of 5'UTR sequence of escherichia coli T7 phage gene 10, 3'-end non-coding area of tobacco chloroplast rps16 gene, enterobacter aerogenes polyphosphate kinase gene ppk and pseudomonas K-62 strain on the basis of plasmid pET28a and by eliminating mer operon of merA and merG. Organic mercury and inorganic mercury in wastewater are transferred into bacterial cells through merT-merP, the organic mercury is degraded into divalent mercury through merB1 and merB2, the divalent mercury is chelated into the cells through ppk, the toxicity of mercury to the bacteria cells is reduced, mercury in the wastewater is accumulated inside the bacterial cells, and mercury pollution in the waster is eliminated through collecting the recombinant engineering bacteria.

Description

technical field [0001] The invention relates to a recombinant plasmid used for removing mercury pollution from industrial wastewater, and also relates to a construction method of the recombinant plasmid, a recombinant engineering bacterium containing the recombinant plasmid and an application of the recombinant engineering bacterium, belonging to the technical field of genetic engineering. Background technique [0002] Soil is one of the main natural resources that human beings rely on for survival, and it is also an important part of the human ecological environment. With the intensification of industrial and urban pollution and the increase in the types and quantities of agricultural chemicals, soil heavy metal pollution is becoming more and more serious. Mercury is one of the major heavy metal pollutants. Heavy metal pollution in agricultural soil mainly comes from sewage irrigation. According to the national survey of sewage irrigation areas conducted by the Ministry o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N1/21C12N15/66C02F3/34C12R1/19
Inventor 舒海燕常胜合
Owner 舒海燕
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com