Probe, kit and method for detecting R47H mutation of TREM2 gene

A detection method and kit technology, applied in the field of biomedicine, can solve the problem of high technical requirements, and achieve the effects of no analysis process, rapid detection, and reduction of cross-contamination

Active Publication Date: 2014-02-05
XIAMEN RENRUI BIOMEDICAL TECH CO LTD
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method requires three steps of PCR amplification, annealing, and melting curve analysis, which takes about 3 hours. It is easy to automate and has less human error, but the technical requirements are relatively high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe, kit and method for detecting R47H mutation of TREM2 gene
  • Probe, kit and method for detecting R47H mutation of TREM2 gene
  • Probe, kit and method for detecting R47H mutation of TREM2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The following sequences were artificially synthesized (Invitrogen Company), specifically:

[0040] Forward primer: 5'- GTGTCTTGCCCCTATGACTCCA -3' (SEQ ID NO: 1); upstream of SNP rs75932628,

[0041] Reverse primer: 5'-GTGCTCCCATTCCACCTCCT-3' (SEQ ID NO: 2); located downstream of SNP rs75932628.

[0042] The wild-type probe is a FAM fluorescent group and a BHQ1 quencher group coupled to the 5' and 3' ends of the sequence SEQ ID NO:3, respectively;

[0043] The mutant probe is that the 5' and 3' ends of the sequence SEQ ID NO: 4 are coupled with a HEX fluorescent group and a BHQ1 quencher group respectively.

[0044] SEQ ID NO: 3: 5'CGGTCAACTGGGGGAGGCGCAAGGTGACCG 3'

[0045] SEQ ID NO: 4: 5'CGCGTATGGGGGAGGCACAAGGCTACGCG 3'

[0046] The PCR amplification system is:

[0047] 2× Amplification Master Mix 5.0ul

[0048] Forward primer (100uM) 0.325ul

[0049] Reverse primer (100uM) 0.325ul

[0050] Wild type probe (100uM) 0.325ul

[0051] Mutant probe (100uM) 0.32...

Embodiment 2

[0057] Example 2: Detection of unknown human DNA samples

[0058] According to the method and steps of Example 1, PCR amplification was carried out.

[0059] The templates are: known TREM2 The positive standard WT of the genotype is the positive standard 1 (Shanghai Biological Synthesis); known TREM2 The positive standard product R47H of the genotype is the positive standard product 2 (Shanghai Bio-Synthetics); known TREM2 The positive standard WT / R47H of the genotype is the positive standard 3 (mixed in equal amounts by the positive standard WT and the positive standard R47H); the test results of a human DNA test sample (Xiamen Zhongshan Hospital) are shown in Figure 5. Figure 5A is known TREM2 Genotype positive standard 1 has only FAM fluorescence signal, which is homozygous for WT / WT (that is, the rs75932628 locus is G / G), which is consistent with the actual situation; Figure 5B is known TREM2 The genotype positive standard 2 has only HEX fluorescence signal, which i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a probe, a kit and a method for detecting R47H mutation of a TREM2 gene. The probe can detect whether base G on rs75932628 locus of the TREM2 gene is mutated to A. The probe can realize single tube enclosing and rapidly and simply detect R47H mutation of the TREM2 gene in a sample, and greatly reduces the chance of cross contamination; the method has simple operation and fast detection only requiring 1.5 h; and the detection results are intuitive, and three genotypes of TREM2 in a sample can be determined qualitatively according to different fluorescence signals, without complex analysis process.

Description

technical field [0001] The present invention relates to the field of biomedicine. Specifically, it relates to a probe, a kit and a method for detecting the R47H mutation of the TREM2 gene. Background technique [0002] Myeloid cells express triggering receptor 2 (triggering receptors expressed on myeloid cells, TREM2) is one of the immunoglobulin superfamily receptor members, mainly expressed in monocytes / macrophages, neutrophils, dendritic cells, On bone cells, participates in the innate immune response and is able to regulate the developmental phase of the response. The gene encoding TREM2 is located on chromosome 6 and spans 4.7kb DNA in full length. The encoded protein contains 230 amino acids and has a molecular weight of 25.447KDa. It is expressed in the brain, lung, blood, heart, skin and saliva, and is expressed in the human brain Among them, the expression level of TREM2 is very high in the white matter, hippocampus and neocortex, while the expression level is low...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11C12M1/34
CPCC12Q1/686C12Q1/6883C12Q2563/107C12Q2600/156G01N21/6486C12Q2531/113
Inventor 张含钟力康冉冉张云武卜国军许华曦
Owner XIAMEN RENRUI BIOMEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap