Probe, kit and method for detecting R47H mutation of TREM2 gene
A detection method and kit technology, applied in the field of biomedicine, can solve the problem of high technical requirements, and achieve the effects of no analysis process, rapid detection, and reduction of cross-contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The following sequences were artificially synthesized (Invitrogen Company), specifically:
[0040] Forward primer: 5'- GTGTCTTGCCCCTATGACTCCA -3' (SEQ ID NO: 1); upstream of SNP rs75932628,
[0041] Reverse primer: 5'-GTGCTCCCATTCCACCTCCT-3' (SEQ ID NO: 2); located downstream of SNP rs75932628.
[0042] The wild-type probe is a FAM fluorescent group and a BHQ1 quencher group coupled to the 5' and 3' ends of the sequence SEQ ID NO:3, respectively;
[0043] The mutant probe is that the 5' and 3' ends of the sequence SEQ ID NO: 4 are coupled with a HEX fluorescent group and a BHQ1 quencher group respectively.
[0044] SEQ ID NO: 3: 5'CGGTCAACTGGGGGAGGCGCAAGGTGACCG 3'
[0045] SEQ ID NO: 4: 5'CGCGTATGGGGGAGGCACAAGGCTACGCG 3'
[0046] The PCR amplification system is:
[0047] 2× Amplification Master Mix 5.0ul
[0048] Forward primer (100uM) 0.325ul
[0049] Reverse primer (100uM) 0.325ul
[0050] Wild type probe (100uM) 0.325ul
[0051] Mutant probe (100uM) 0.32...
Embodiment 2
[0057] Example 2: Detection of unknown human DNA samples
[0058] According to the method and steps of Example 1, PCR amplification was carried out.
[0059] The templates are: known TREM2 The positive standard WT of the genotype is the positive standard 1 (Shanghai Biological Synthesis); known TREM2 The positive standard product R47H of the genotype is the positive standard product 2 (Shanghai Bio-Synthetics); known TREM2 The positive standard WT / R47H of the genotype is the positive standard 3 (mixed in equal amounts by the positive standard WT and the positive standard R47H); the test results of a human DNA test sample (Xiamen Zhongshan Hospital) are shown in Figure 5. Figure 5A is known TREM2 Genotype positive standard 1 has only FAM fluorescence signal, which is homozygous for WT / WT (that is, the rs75932628 locus is G / G), which is consistent with the actual situation; Figure 5B is known TREM2 The genotype positive standard 2 has only HEX fluorescence signal, which i...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com