Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of dsRNA that inhibits the gene expression of wheat aphid cytochrome c oxidase viic subunit and its application

A cytochrome and gene technology, applied in the field of dsRNA, can solve the problem of decreased expression of target genes

Active Publication Date: 2016-01-27
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process of RNAi is that double-stranded RNA (dsRNA) enters the organism and is cut into 21-23nt siRNA by Dicer enzyme. The siRNA binds to the RNA-induced silencing complex, binds to the target mRNA of complementary sequence, and is recognized by Dicer, resulting in the expression of the target gene decline in volume

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of dsRNA that inhibits the gene expression of wheat aphid cytochrome c oxidase viic subunit and its application
  • A kind of dsRNA that inhibits the gene expression of wheat aphid cytochrome c oxidase viic subunit and its application
  • A kind of dsRNA that inhibits the gene expression of wheat aphid cytochrome c oxidase viic subunit and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Preparation of dsRNA for silencing cytochrome C oxidase VIIc subunit gene

[0022] 1. Extract the total RNA of Piper aphid and reverse transcribed into cDNA.

[0023] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification with a pair of primers composed of P1-F and P1-R to obtain PCR amplification products. See the agarose gel electrophoresis diagram of PCR amplification products figure 1 A.

[0024] P1-F (upstream primer): TAATACGACTCACTATAGGG AGTGGTTCAAAAGCCGTACAAGCGT;

[0025] P1-R (downstream primer): TAATACGACTCACTATAGGG AGGGAAGACCAAAACCGGTGCTAAAGA.

[0026] The underlined region is the T7 promoter sequence.

[0027] PCR reaction system: 10×PCRBuffer 5μL, dNTP (2.5mmol·L -1 ) 4μL, rTaq0.5μL, upstream primer (20μmol·L -1 ) 1μL, downstream primer (20μmol·L -1 ) 1μL, template 1μL, use ddH 2 O make up to 50μL.

[0028] PCR reaction conditions: 94℃4min; 94℃30s, 55℃30s, 72℃30s, 39 cycles; 72℃10min; 4℃ storage.

[0029] 3. Preparation of dsRNA-1

[0...

Embodiment 2

[0032] Example 2. Preparation of dsRNA for silencing GFP gene

[0033] 1. Synthesize the double-stranded DNA molecule shown in Sequence 3 of the Sequence Listing.

[0034] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, use the primer pair composed of P4-F and P4-R to perform PCR amplification to obtain the PCR amplification product. See the agarose gel electrophoresis diagram of the PCR amplification product figure 1 B.

[0035] P4-F (upstream primer): TAATACGACTCACTATAGGG ACGGGAACTACAAGACACG;

[0036] P4-R (downstream primer): TAATACGACTCACTATAGGG CTTTGGAAAGGGCAGATT.

[0037] The PCR reaction system and PCR reaction conditions are the same as the PCR reaction system and PCR reaction conditions in step 2 of Example 1.

[0038] 3. Preparation of dsRNA-2

[0039] The PCR amplification product obtained in step 2 was recovered and used as a template, and T7 in vitro transcription kit was used for in vitro transcription (incubated at 42°C for 16 hours), and the r...

Embodiment 3

[0041] Example 3. Application of dsRNA in inhibiting the growth of aphids

[0042] 1. Preparation of artificial feed for aphid and preparation of feeding device

[0043] See references for the preparation method of artificial feed and the structure of the incubator (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on feeding aphids with pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228. LiCX , GaoLF, GaoLL, LiRZ.Studyontherearingofaphidsonaartificiallyholidic diets.Journal of Shanxi Agricultural University,1997,17(3):225-228.(in Chinese)). Filter the artificial feed with a 0.2μm pore size bacterial filter, divide it into 2.0mL sterilized centrifuge tubes, and store it in a refrigerator at -20°C to avoid repeated freezing and thawing.

[0044] 2. Application of dsRNA in inhibiting the growth of aphids

[0045] See reference for the feeding method of Pipe aphid: Jiao Min, Liu Shusheng. The technology of raising aphids with artifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome C oxidase VIIc subunit gene and application thereof. The invention provides a dsRNA molecule disclosed as Sequence 2 in the sequence table. The invention also provides a DNA (deoxyribonucleic acid) molecule for coding the RNA molecule. The invention also provides application of the RNA molecule or the DNA molecule, which is at least one of the following (1) to (4): (1) preventing and treating aphids; (2) promoting death of aphids; (3) inhibiting growth of aphids; and (4) inhibiting expression of the aphid in-vivo cytochrome C oxidase VIIc subunit gene. The dsRNA has important application value in preventing and treating aphids in agricultural production.

Description

Technical field [0001] The invention relates to a dsRNA that inhibits the expression of the wheat aphid cytochrome C oxidase VIIc subunit gene and its application. Background technique [0002] Wheat aphids (especially the wheat aphid) are one of the main pests that endanger China's wheat production. According to statistics, China's annual wheat aphids damage area can reach 17 million hectares, accounting for 62% of the total wheat planting area, resulting in a 15% reduction in production- 30%, up to 50% in severe cases. In recent years, due to global warming, changes in farming systems and other factors, the reproductive capacity and adaptability of aphids have been significantly enhanced, and their harm has become increasingly serious. At present, pesticide spraying is the main focus of aphid prevention and control. The large-scale use of pesticides is not only harmful to humans and animals, but also causes serious environmental pollution. Cultivating aphid-resistant wheat va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A01N57/16A61P7/04
Inventor 夏兰琴王大海孙永伟杜文明
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com