A kind of dsRNA that inhibits the gene expression of wheat aphid cytochrome c oxidase viic subunit and its application
A cytochrome and gene technology, applied in the field of dsRNA, can solve the problem of decreased expression of target genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Preparation of dsRNA for silencing cytochrome C oxidase VIIc subunit gene
[0022] 1. Extract the total RNA of Piper aphid and reverse transcribed into cDNA.
[0023] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification with a pair of primers composed of P1-F and P1-R to obtain PCR amplification products. See the agarose gel electrophoresis diagram of PCR amplification products figure 1 A.
[0024] P1-F (upstream primer): TAATACGACTCACTATAGGG AGTGGTTCAAAAGCCGTACAAGCGT;
[0025] P1-R (downstream primer): TAATACGACTCACTATAGGG AGGGAAGACCAAAACCGGTGCTAAAGA.
[0026] The underlined region is the T7 promoter sequence.
[0027] PCR reaction system: 10×PCRBuffer 5μL, dNTP (2.5mmol·L -1 ) 4μL, rTaq0.5μL, upstream primer (20μmol·L -1 ) 1μL, downstream primer (20μmol·L -1 ) 1μL, template 1μL, use ddH 2 O make up to 50μL.
[0028] PCR reaction conditions: 94℃4min; 94℃30s, 55℃30s, 72℃30s, 39 cycles; 72℃10min; 4℃ storage.
[0029] 3. Preparation of dsRNA-1
[0...
Embodiment 2
[0032] Example 2. Preparation of dsRNA for silencing GFP gene
[0033] 1. Synthesize the double-stranded DNA molecule shown in Sequence 3 of the Sequence Listing.
[0034] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, use the primer pair composed of P4-F and P4-R to perform PCR amplification to obtain the PCR amplification product. See the agarose gel electrophoresis diagram of the PCR amplification product figure 1 B.
[0035] P4-F (upstream primer): TAATACGACTCACTATAGGG ACGGGAACTACAAGACACG;
[0036] P4-R (downstream primer): TAATACGACTCACTATAGGG CTTTGGAAAGGGCAGATT.
[0037] The PCR reaction system and PCR reaction conditions are the same as the PCR reaction system and PCR reaction conditions in step 2 of Example 1.
[0038] 3. Preparation of dsRNA-2
[0039] The PCR amplification product obtained in step 2 was recovered and used as a template, and T7 in vitro transcription kit was used for in vitro transcription (incubated at 42°C for 16 hours), and the r...
Embodiment 3
[0041] Example 3. Application of dsRNA in inhibiting the growth of aphids
[0042] 1. Preparation of artificial feed for aphid and preparation of feeding device
[0043] See references for the preparation method of artificial feed and the structure of the incubator (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on feeding aphids with pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228. LiCX , GaoLF, GaoLL, LiRZ.Studyontherearingofaphidsonaartificiallyholidic diets.Journal of Shanxi Agricultural University,1997,17(3):225-228.(in Chinese)). Filter the artificial feed with a 0.2μm pore size bacterial filter, divide it into 2.0mL sterilized centrifuge tubes, and store it in a refrigerator at -20°C to avoid repeated freezing and thawing.
[0044] 2. Application of dsRNA in inhibiting the growth of aphids
[0045] See reference for the feeding method of Pipe aphid: Jiao Min, Liu Shusheng. The technology of raising aphids with artifi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com