Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression method of antibacterial peptide Hclocidin18 in escherichia coli

An expression method, the technology of Escherichia coli, which is applied in the field of biotechnology and biomedicine, can solve problems such as difficult expression, and achieve the effect of efficient recovery

Inactive Publication Date: 2014-03-26
ZHEJIANG MARINE DEV RES INST
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the antibacterial activity of antimicrobial peptides against bacteria, it is difficult to express them in the E. coli expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0017] Bacterial Strains: E. coli DH5α was used for the construction of recombinant plasmids, E. coli BL21 was used as the expression strain. Staphylococcus aureus was used as a typical Gram-positive strain for the detection of antibacterial activity.

[0018] 1. PET30a-polh-Hclocidin18 plasmid construction: The antimicrobial peptide Hclocidin18 used for expression in the present invention is a molecularly modified sequence, hereinafter referred to as the Hclocidin18 gene, and its nucleotide sequence is tggttgaacgcacttttgcatcacggacttaattgcgctaaaggtgttcttgct (SEQ ID No. 2).

[0019] The Hclocidin18 gene was synthesized by Shanghai Sangon Chemical Co., Ltd., and the coding sequence of the hydroxylamine cleavage site (Asn-Gly) was added in front of the Hclocidin18 gene. EcoR I was added to the 5' end of the gene fragment, and Xho I was added to the 3' end of the gene fragment. After synthesis, it was cloned into the plasmid pUC18 , the recombinant plasmid pUC18-Hclocidin18 wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the biotechnology field and the technical field of biological medicines, and particularly relates to an expression method of an antibacterial peptide Hclocidin18 in escherichia coli. The expression method is characterized by comprising following steps of: a. plasmid construction, wherein the escherichia coli is utilized to perform recombinant plasmid construction, and a polyhedron of a bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is utilized as a fusion partner; b. induction expression; c. purification of a fusion protein coded by the recombinant plasmid; and d. schizolysis of the fusion protein and collection of the antibacterial peptide Hclocidin18. The polyhedron of the bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is utilized as the fusion partner to achieve success expression of the antibacterial peptide Hclocidin18 in the escherichia coli. The alkali dissolution characteristic of the polyhedron is utilized to achieve efficient recovery of the antibacterial peptide Hclocidin18.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biomedicine, in particular to a method for expressing the antibacterial peptide Hclocidin18 in Escherichia coli. Background technique [0002] Halocidin is a class derived from sea squirts ( Halocynthia aurantium ), the natural Halocidin contains two subunits, the subunit of 18 amino acid residues (Hclocidin 18) and the subunit of 15 amino acid residues (Hclocidin 15) are bound together by disulfide bonds. Hclocidin18 has good antibacterial activity, and has attracted much attention because of its strong killing effect on many pathogenic Gram-positive bacteria in the intestinal tract of livestock and poultry. Its antibacterial effect is equivalent to that of antibiotics, and it is the most promising substitute for antibiotics. The biosynthesis of antimicrobial peptides is also a hot research topic for many researchers. Due to the antibacterial activity of antimicrobial peptides again...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/70C07K14/435
Inventor 相兴伟周宇芳江玲丽杨会成孔寅飞郑斌
Owner ZHEJIANG MARINE DEV RES INST