Expression method of antibacterial peptide Hclocidin18 in escherichia coli
An expression method, the technology of Escherichia coli, which is applied in the field of biotechnology and biomedicine, can solve problems such as difficult expression, and achieve the effect of efficient recovery
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0017] Bacterial Strains: E. coli DH5α was used for the construction of recombinant plasmids, E. coli BL21 was used as the expression strain. Staphylococcus aureus was used as a typical Gram-positive strain for the detection of antibacterial activity.
[0018] 1. PET30a-polh-Hclocidin18 plasmid construction: The antimicrobial peptide Hclocidin18 used for expression in the present invention is a molecularly modified sequence, hereinafter referred to as the Hclocidin18 gene, and its nucleotide sequence is tggttgaacgcacttttgcatcacggacttaattgcgctaaaggtgttcttgct (SEQ ID No. 2).
[0019] The Hclocidin18 gene was synthesized by Shanghai Sangon Chemical Co., Ltd., and the coding sequence of the hydroxylamine cleavage site (Asn-Gly) was added in front of the Hclocidin18 gene. EcoR I was added to the 5' end of the gene fragment, and Xho I was added to the 3' end of the gene fragment. After synthesis, it was cloned into the plasmid pUC18 , the recombinant plasmid pUC18-Hclocidin18 wa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com