Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus subtilis strain WB1 for resisting botryosphaeria dothidea and application of bacillus subtilis strain WB1

A technology of walnut canker and endophytic bacteria, applied in the direction of application, bacteria, and biocides, can solve the problems of long time-consuming, long incubation period, and high cost of prevention and control

Active Publication Date: 2014-04-16
NORTHWEST A & F UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the disease hides and hides under the bark in the early stage of infection, the symptoms of damage on the surface of the bark are not obvious at the early stage of infection, and fruit farmers tend to ignore its existence, and because of its long incubation period, long disease cycle and multi-point damage. In the prevention and control, it needs multiple treatments and multiple application of chemical pesticides in one growth cycle, so as to better control its harm
There are problems such as high cost of prevention and control, long time consumption, and environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis strain WB1 for resisting botryosphaeria dothidea and application of bacillus subtilis strain WB1
  • Bacillus subtilis strain WB1 for resisting botryosphaeria dothidea and application of bacillus subtilis strain WB1
  • Bacillus subtilis strain WB1 for resisting botryosphaeria dothidea and application of bacillus subtilis strain WB1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Screening and identification of walnut canker antagonistic bacteria

[0061] 1. The applicant's research group isolated a strain from walnut bark samples collected in Wugong area, Shaanxi, China. The specific isolation method is: take fresh bark from healthy walnut plants, use PDA medium to separate, cultivate and purify . Then adopt the confrontation culture method to utilize the PDA plate to screen the bacterial strain with the strongest bacteriostatic effect on walnut canker, as a result, obtain an endophyte bacterial strain with stronger antagonistic effect on walnut canker, and the applicant named it Bacillus subtilis ( Bacillus subtilis strain WB1) strain, the antagonistic effect of the Bacillus subtilis strain WB1 on walnut canker and walnut rot fungus is as follows: figure 1 , as shown in 3.

[0062] 2. Species identification of Bacillus subtilis strain WB1

[0063] The strain of Bacillus subtilis strain WB1 was identified by conventional physiolog...

Embodiment 2

[0094] Example 2: Indoor cultivation of Bacillus subtilis strain (Bacillus subtilis strain WB1) strain and gene characteristics of antibiotic production

[0095] The seed culture conditions of the Bacillus subtilis strain (Bacillus subtilis strain WB1) are:

[0096] PDA medium (pH7.0-8.5), culture temperature 25°C-30°C, dark conditions.

[0097] The fermentation broth culture condition of this bacterial strain is:

[0098] LB liquid medium, pH7.0-8.0, rotation speed 80-150rpm, culture temperature 25°C-30°C.

[0099] Using the genomic DNA of Bacillus subtilis strain (Bacillus subtilis strain WB1) as a template, and using bacterial antibiotic sequence universal primers as primers, the 774pb antibiotic gene sequence was obtained by PCR product sequencing.

[0100] The antibiotic TasA gene sequence of the Bacillus subtilis strain (Bacillus subtilis strain WB1) strain is as follows:

[0101] 1ggagaaaaagaaattgagtttaggagttgcttctgcagcactaggattaggttttagttgg

[0102] 61 aggaggaacatg...

Embodiment 3

[0114] Example 3: Evaluation of the antagonistic effect of Bacillus subtilis strain WB1 on walnut canker etc.

[0115] 1. Indoor activity determination

[0116] The bacillus subtilis strain (Bacillus subtilis strain WB1) can strongly inhibit walnut canker, walnut rot fungus, horse chestnut canker and poplar canker in confrontation culture on a PDA plate. image 3 A shows the streak culture of Bacillus subtilis strain WB1 and walnut canker on the PDA plate, image 3 B shows the confrontation culture of Bacillus subtilis strain WB1 strain and walnut rot pathogen.

[0117] 2. Field control test

[0118] During the onset period of walnut canker and horse chestnut canker in the first ten days of June, select plants with relatively consistent incidence in the field, cut the epidermis of canker lesions with a knife, smear Bacillus subtilis strain WB1 strain fermentation liquid, and in 8 At the end of the month, the cure rate of lesions and the number of new lesions were counted. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bacillus subtilis strain WB1. Fermentation products, obtained through fermentation cultivation, of the strain can be used for preventing various forest-crop diseases such as botryosphaeria dothidea, valsa sp., B.dothidea and B.dothidea. The strain is preserved in the general microbiology center of the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.8439. The acquisition of the strain is hopeful to provide a safe, environment-friendly and effective approach for the prevention of the botryosphaeria dothidea and the like, and the application prospect is good.

Description

technical field [0001] The invention relates to the field of microorganisms and applications thereof, in particular to an endophytic bacterium capable of antagonizing walnut canker and its application in preventing and treating walnut canker. Background technique [0002] Plant endophytes refer to microorganisms that live in various tissues and organs of healthy plants during a certain stage or all stages of their life history. Endophytes have attracted much attention due to their powerful physiological and ecological functions such as dissolving phosphorus, fixing nitrogen, producing plant hormones, inducing insect and disease resistance, and stress resistance. In recent years, it has been found that many plant endophytes can also produce secondary metabolites with pesticide activity, which has aroused great interest. Finding and discovering new lead compounds from microorganisms is an important way to develop new pesticides. Because endophytic bacteria have a stable livi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/02A01P1/00C12R1/125
Inventor 唐光辉余仲东王娇莉王敦冯纪年
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More