Bacillus subtilis strain WB1 for resisting botryosphaeria dothidea and application of bacillus subtilis strain WB1
A technology of walnut canker and endophytic bacteria, applied in the direction of application, bacteria, and biocides, can solve the problems of long time-consuming, long incubation period, and high cost of prevention and control
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1: Screening and identification of walnut canker antagonistic bacteria
[0061] 1. The applicant's research group isolated a strain from walnut bark samples collected in Wugong area, Shaanxi, China. The specific isolation method is: take fresh bark from healthy walnut plants, use PDA medium to separate, cultivate and purify . Then adopt the confrontation culture method to utilize the PDA plate to screen the bacterial strain with the strongest bacteriostatic effect on walnut canker, as a result, obtain an endophyte bacterial strain with stronger antagonistic effect on walnut canker, and the applicant named it Bacillus subtilis ( Bacillus subtilis strain WB1) strain, the antagonistic effect of the Bacillus subtilis strain WB1 on walnut canker and walnut rot fungus is as follows: figure 1 , as shown in 3.
[0062] 2. Species identification of Bacillus subtilis strain WB1
[0063] The strain of Bacillus subtilis strain WB1 was identified by conventional physiolog...
Embodiment 2
[0094] Example 2: Indoor cultivation of Bacillus subtilis strain (Bacillus subtilis strain WB1) strain and gene characteristics of antibiotic production
[0095] The seed culture conditions of the Bacillus subtilis strain (Bacillus subtilis strain WB1) are:
[0096] PDA medium (pH7.0-8.5), culture temperature 25°C-30°C, dark conditions.
[0097] The fermentation broth culture condition of this bacterial strain is:
[0098] LB liquid medium, pH7.0-8.0, rotation speed 80-150rpm, culture temperature 25°C-30°C.
[0099] Using the genomic DNA of Bacillus subtilis strain (Bacillus subtilis strain WB1) as a template, and using bacterial antibiotic sequence universal primers as primers, the 774pb antibiotic gene sequence was obtained by PCR product sequencing.
[0100] The antibiotic TasA gene sequence of the Bacillus subtilis strain (Bacillus subtilis strain WB1) strain is as follows:
[0101] 1ggagaaaaagaaattgagtttaggagttgcttctgcagcactaggattaggttttagttgg
[0102] 61 aggaggaacatg...
Embodiment 3
[0114] Example 3: Evaluation of the antagonistic effect of Bacillus subtilis strain WB1 on walnut canker etc.
[0115] 1. Indoor activity determination
[0116] The bacillus subtilis strain (Bacillus subtilis strain WB1) can strongly inhibit walnut canker, walnut rot fungus, horse chestnut canker and poplar canker in confrontation culture on a PDA plate. image 3 A shows the streak culture of Bacillus subtilis strain WB1 and walnut canker on the PDA plate, image 3 B shows the confrontation culture of Bacillus subtilis strain WB1 strain and walnut rot pathogen.
[0117] 2. Field control test
[0118] During the onset period of walnut canker and horse chestnut canker in the first ten days of June, select plants with relatively consistent incidence in the field, cut the epidermis of canker lesions with a knife, smear Bacillus subtilis strain WB1 strain fermentation liquid, and in 8 At the end of the month, the cure rate of lesions and the number of new lesions were counted. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



