Supercharge Your Innovation With Domain-Expert AI Agents!

Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis

A quantitative detection and methylation technology, applied in the determination/testing of microorganisms, biochemical equipment and methods, fluorescence/phosphorescence, etc., can solve the problems of dangerous diseases, poor prognosis, and high mortality

Inactive Publication Date: 2014-05-21
SHANDONG UNIV QILU HOSPITAL
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The condition of ACHBLF is dangerous, the prognosis is poor, and the mortality rate is extremely high. At present, there is no effective method and means to evaluate the condition and predict the prognosis clinically.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis
  • Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis
  • Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0042] The main reagents in the GSTP1 gene methylation quantitative detection kit for predicting the prognosis of liver failure include: reagents for extracting genomic DNA from samples to be tested, reagents for modifying genomic DNA with bisulfite, 5× premixed PCR reaction system, standard products, positive Control, negative control, methylation-specific primer pair for the promoter of the target gene GSTP1 and a specific primer pair for the internal reference gene ALU-C4 and the corresponding Taqman fluorescent probe, the specific sequences are as follows:

[0043] GSTP1-upstream primer: 5'TTCGGGGTGTAGCGGTCGTC 3';

[0044] GSTP1-downstream primer: 5'GCCCCAATACTAAATCACGACG 3';

[0045] GSTP1-probe: 5'Fam AAATCCCGCGAACTCCCGCC 3'BHQ1;

[0046] ALU-C4-upstream primer: 5'GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA 3';

[0047] ALU-C4-downstream primer: 5'ATTAACTAAACTAAATCTTAAACTCCTAACCTCA 3';

[0048] ALU-C4-probe: 5'Fam CCTACCTTAACCTCCC 3'BHQ1.

[0049] Among them, the reagents f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a quantitative detection method and a reagent kit GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis. The invention relates to quantitative detection for gene methylation, and in particular relates to a quantitative detection method and a reagent kit f GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis. The reagent kit contains a reagent for extracting genomic DNA (Deoxyribonucleic Acid), a reagent for modifying the genomic DNA, a 5x premixing PCR (Polymerase Chain Reaction) system, a standard substance, positive and negative control, a methylation-specific primer pair aiming at a target gene GSTP1 promoter, a specific primer pair of a reference gene ALU-C4, and a corresponding Taqman fluorescent probe. By extracting peripheral blood genomic DNA and carrying out real-time fluorescence quantitative PCR, a quantitative value of the gene GSTP1 methylation is obtained through calculation. The reagent kit provided by the invention can help doctors to determine the pathogenetic condition and prognosis of hepatic failure patients so as to make effective treatment plans.

Description

technical field [0001] The invention relates to the technical field of quantitative detection of gene promoter methylation, in particular to a method for quantitative detection of glutathione S-transferase P1 (GSTP1) gene promoter methylation and a kit for predicting the prognosis of liver failure. Background technique [0002] Liver failure is a common severe liver disease syndrome in clinical practice. It is a syndrome in which a large number of liver cells are necrotic due to various factors, causing severe liver damage, resulting in decompensation or serious impairment of liver synthesis, excretion, detoxification, and biotransformation. . Liver failure mainly manifests as jaundice, coagulation dysfunction, hepatic encephalopathy and ascites. Acute-on-chronic liver failure (ACLF) refers to the rapid deterioration of liver function in a short period of time on the basis of chronic liver disease, leading to liver failure. The main cause of liver failure in my country is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N21/64
CPCC12Q1/686C12Q1/6851
Inventor 王凯赵静王丽媛孙丰凯高帅范玉琛范晓鹏
Owner SHANDONG UNIV QILU HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More