PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit and detection method for growth-rate-related gene Leptin of Gansu alpine fine-wool sheep
A detection kit and growth rate technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of no polymorphism found, and achieve improved production performance, high sensitivity, and strong specificity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: A PCR-SSCP detection kit for the growth rate-related gene Leptin of Gansu alpine fine-wool sheep, including PCR reaction solution, DNA standard sample of Leptin*C; deionized water, 10% ammonium persulfate, sample loading Denaturing buffer, TEMED, 12% non-denaturing polyacrylamide gel Arc:Bis=37.5:1;
[0045] The loading denaturing buffer includes 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTA pH8.0;
[0046] The reaction solution of the PCR reaction solution: the total volume is 20 μL, of which the 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F: 5'TACCAACAGATCCTCGCCAGTC3' and Leptin-R: 5'CTTCAAGGCTTCAGCACCCA3' are each 0.1μM, Taq polymerase 0.5U, ddH 2 O make up the volume to 20 μL.
[0047] The nucleotide sequence of the DNA standard sample of the Leptin*C is:
[0048]
Embodiment 2
[0049] Embodiment 2: the method for using the PCR-SSCP detection kit of the growth rate-related gene Leptin of the Gansu alpine fine-wool sheep, the steps are:
[0050] (1) 1μL / 50ng of Gansu alpine fine-wool sheep genomic DNA to be tested was mixed with the PCR amplification solution in the kit. Reaction conditions: pre-denaturation at 94°C for 3min, denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, a total of 35 samples Cycle, and finally extend at 72°C for 10 minutes;
[0051] (2) Use the PCR product amplified in step (1) and the DNA standard sample of Leptin*C to mix with the components of the SSCP detection reagent in the kit for SSCP detection;
[0052] (3) The samples whose banding pattern detected in step (2) was consistent with the Leptin*C standard transect were individuals carrying alleles controlling the growth rate of Gansu alpine fine-wool sheep.
Embodiment 3
[0053] Embodiment 3: a kind of PCR-SSCP detection method of Gansu alpine fine-wool sheep growth rate-related gene Leptin, characterized in that the detection steps are:
[0054] (1) Sample collection: 10ml of blood was collected from the jugular vein of Gansu alpine fine-wool sheep, anticoagulated with ACD, and stored at -20°C;
[0055] (2) Genomic DNA extraction: Genomic DNA was extracted from frozen blood samples by conventional phenol-chloroform extraction;
[0056] (3) Polymerase chain reaction:
[0057] PCR reaction system: total volume 20 μL, of which 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F and Leptin-R are 0.1μM each, Taq polymerase 0.5U, template DNA 50ng, ddH 2 O supplement volume to 20 μL; reaction conditions: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 30 s, a total of 35 cycles, and final extension at 72°C ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 