Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit and detection method for growth-rate-related gene Leptin of Gansu alpine fine-wool sheep

A detection kit and growth rate technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problem of no polymorphism found, and achieve improved production performance, high sensitivity, and strong specificity. Effect

Active Publication Date: 2014-06-25
GANSU AGRI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Up to now, 5 alleles have been found on the third exon of the sheep Leptin gene (Zhou et al., 2009), and no polymorphisms have been found on the second exon (Huang Danli et al., 2008)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit and detection method for growth-rate-related gene Leptin of Gansu alpine fine-wool sheep
  • PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit and detection method for growth-rate-related gene Leptin of Gansu alpine fine-wool sheep
  • PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit and detection method for growth-rate-related gene Leptin of Gansu alpine fine-wool sheep

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: A PCR-SSCP detection kit for the growth rate-related gene Leptin of Gansu alpine fine-wool sheep, including PCR reaction solution, DNA standard sample of Leptin*C; deionized water, 10% ammonium persulfate, sample loading Denaturing buffer, TEMED, 12% non-denaturing polyacrylamide gel Arc:Bis=37.5:1;

[0045] The loading denaturing buffer includes 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTA pH8.0;

[0046] The reaction solution of the PCR reaction solution: the total volume is 20 μL, of which the 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F: 5'TACCAACAGATCCTCGCCAGTC3' and Leptin-R: 5'CTTCAAGGCTTCAGCACCCA3' are each 0.1μM, Taq polymerase 0.5U, ddH 2 O make up the volume to 20 μL.

[0047] The nucleotide sequence of the DNA standard sample of the Leptin*C is:

[0048]

Embodiment 2

[0049] Embodiment 2: the method for using the PCR-SSCP detection kit of the growth rate-related gene Leptin of the Gansu alpine fine-wool sheep, the steps are:

[0050] (1) 1μL / 50ng of Gansu alpine fine-wool sheep genomic DNA to be tested was mixed with the PCR amplification solution in the kit. Reaction conditions: pre-denaturation at 94°C for 3min, denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, a total of 35 samples Cycle, and finally extend at 72°C for 10 minutes;

[0051] (2) Use the PCR product amplified in step (1) and the DNA standard sample of Leptin*C to mix with the components of the SSCP detection reagent in the kit for SSCP detection;

[0052] (3) The samples whose banding pattern detected in step (2) was consistent with the Leptin*C standard transect were individuals carrying alleles controlling the growth rate of Gansu alpine fine-wool sheep.

Embodiment 3

[0053] Embodiment 3: a kind of PCR-SSCP detection method of Gansu alpine fine-wool sheep growth rate-related gene Leptin, characterized in that the detection steps are:

[0054] (1) Sample collection: 10ml of blood was collected from the jugular vein of Gansu alpine fine-wool sheep, anticoagulated with ACD, and stored at -20°C;

[0055] (2) Genomic DNA extraction: Genomic DNA was extracted from frozen blood samples by conventional phenol-chloroform extraction;

[0056] (3) Polymerase chain reaction:

[0057] PCR reaction system: total volume 20 μL, of which 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F and Leptin-R are 0.1μM each, Taq polymerase 0.5U, template DNA 50ng, ddH 2 O supplement volume to 20 μL; reaction conditions: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 30 s, a total of 35 cycles, and final extension at 72°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sheep growth rate molecular marker assisted breeding technique in the technical field of animal biology and particularly relates to a detection kit for an allelic gene of growth-rate-related gene Leptin of Gansu alpine fine-wool sheep. A PCR (Polymerase Chain Reaction)-SSCP (Single Strand Conformation Polymorphism) detection kit for the growth-rate-related gene Leptin of Gansu alpine fine-wool sheep is characterized by comprising PCR reactant liquid, a DNA standard sample of Leptin*C, an SSCP detection reagent, deionized water, 10% ammonium persulfate, a sampling denaturing buffer solution, TEMED (Tetramethylethylenediamine) and 12% non-denaturing polyacrylamide gel of which Arc: Bis=37.5:1, wherein the sampling denaturing buffer solution comprises 98% of deionized formamide, 0.025% of bromophenol blue, 0.025% of xylene cyanol and 10mmol / L of EDTA (Ethylene Diamine Tetraacetic Acid) of which the pH is 8.0. The detection kit disclosed by the invention has the characteristics of rapidness, high sensitivity, low cost and the like when used in the molecular marker breeding of the Gansu alpine fine-wool sheep.

Description

technical field [0001] The invention relates to sheep molecular marker-assisted breeding technology in the field of animal biotechnology, in particular to a sheep growth speed-related gene detection kit and a detection method thereof. Background technique [0002] Leptin is encoded by the obese gene and is a polypeptide hormone secreted by fat cells (Trayhurn et al., 1996). It can enhance the tolerance of animals to adapt to cold environments by increasing energy release, basal metabolic rate and non-shaking heat production (Peino et al., 2000; Grosfeld et al., 2002; Li et al., 2005), It plays an important role in adapting to the energy balance in high-altitude low-temperature and hypoxic environments. As an important candidate gene for studying growth and development, meat quality and other traits of cattle and sheep, Leptin has effects on pubertal development (Chen et al., 2000), reproductive organ development (Ducy et al., 2000), reproductive performance (Korner et al. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/6888C12Q2600/124C12Q2600/156C12Q2565/131
Inventor 刘秀罗玉柱胡江王继卿李少斌安清明
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com