The pcr-sscp detection kit and detection method of the growth velocity related gene leptin of Gansu alpine fine-wool sheep
A technology for detecting kits and growth rates, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc. It can solve the problems of not finding polymorphisms, etc., and achieve the effects of improved production performance, sensitive response, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: A PCR-SSCP detection kit for the growth rate-related gene Leptin of Gansu alpine fine-wool sheep, including PCR reaction solution, DNA standard sample of Leptin*C; deionized water, 10% ammonium persulfate, sample loading Denaturing buffer, TEMED, 12% non-denaturing polyacrylamide gel Arc:Bis=37.5:1;
[0045] The loading denaturing buffer includes 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTA pH8.0;
[0046] The reaction solution of the PCR reaction solution: the total volume is 20 μL, of which the 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F: 5'TACCAACAGATCCTCGCCAGTC3' and Leptin-R: 5'CTTCAAGGCTTCAGCACCCA3' are each 0.1μM, Taq polymerase 0.5U, ddH 2 O make up the volume to 20 μL.
[0047] The nucleotide sequence of the DNA standard sample of the Leptin*C is:
[0048]
Embodiment 2
[0049] Embodiment 2: the method for using the PCR-SSCP detection kit of the growth rate-related gene Leptin of the Gansu alpine fine-wool sheep, the steps are:
[0050] (1) 1μL / 50ng of Gansu alpine fine-wool sheep genomic DNA to be tested was mixed with the PCR amplification solution in the kit. Reaction conditions: pre-denaturation at 94°C for 3min, denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, a total of 35 samples Cycle, and finally extend at 72°C for 10 minutes;
[0051] (2) Use the PCR product amplified in step (1) and the DNA standard sample of Leptin*C to mix with the components of the SSCP detection reagent in the kit for SSCP detection;
[0052] (3) The samples whose banding pattern detected in step (2) was consistent with the Leptin*C standard transect were individuals carrying alleles controlling the growth rate of Gansu alpine fine-wool sheep.
Embodiment 3
[0053] Embodiment 3: a kind of PCR-SSCP detection method of Gansu alpine fine-wool sheep growth rate-related gene Leptin, characterized in that the detection steps are:
[0054] (1) Sample collection: 10ml of blood was collected from the jugular vein of Gansu alpine fine-wool sheep, anticoagulated with ACD, and stored at -20°C;
[0055] (2) Genomic DNA extraction: Genomic DNA was extracted from frozen blood samples by conventional phenol-chloroform extraction;
[0056] (3) Polymerase chain reaction:
[0057] PCR reaction system: total volume 20 μL, of which 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers Leptin-F and Leptin-R are 0.1μM each, Taq polymerase 0.5U, template DNA 50ng, ddH 2 O supplement volume to 20 μL; reaction conditions: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 30 s, a total of 35 cycles, and final extension at 72°C ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 