A kind of cyclodextrin glycosyltransferase and its preparation method and application
A technology of glycosyltransferase and cyclodextrin, applied in the directions of glycosyltransferase, transferase, botanical equipment and methods, etc., can solve the problems that limit the large-scale production of AA-2G, the conversion rate is not high, and it is not suitable for AA-2G. 2G and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0049] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
[0050] The experimental instruments, materials and reagents involved in this example are as follows:
[0051] Table 1
[0052]
[0053] Table 2
[0054]
[0055]
Embodiment 1
[0056] Example 1: Thermoanaerobacterium xylanolyticumLX-11 gene DNA
[0057] The CGT sequence of Thermoanaerobacterium xylanolyticum LX-11 strain was obtained from the NCBI publication (SequenceID: ref|YP_004470341.1|), synthesized by Zhongmeitaihe Company. like The amino acid sequence shown in SEQ ID NO: 2 is commercially available.
Embodiment 2
[0058] Example 2: Obtainment of DNA fragment encoding wild-type CGTase
[0059] Primers are designed as follows:
[0060] cgt-F:GGAATTCCATATGAAAAAAACCTTCAAAC
[0061] cgt-R:CGCGGATCCAATCTGCTGCCAGTTAACG
[0062] Using the above primers, the cgt gene was amplified by PCR using the genomic DNA extracted in Example 1 as a template.
[0063] The PCR reaction was carried out in a 50 μl system: PrimeStar DNA polymerase 0.5 μl, 5×PSbuffer 10 μl, 10 mM dNTP 4 μl, upstream and downstream primers 2 μl each, template DNA 1 μl, and water was added to make up to 50 μl.
[0064] The reaction conditions were as follows: denaturation at 94°C for 5 min and then cycling, followed by denaturation at 94°C for 45 s, annealing at 55°C for 15 s, and extension at 72°C for 2 min, for a total of 30 cycles, followed by extension at 72°C for 10 min. Amplification yielded a PCR fragment of about 2100 bp.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 