Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of cyclodextrin glycosyltransferase and its preparation method and application

A technology of glycosyltransferase and cyclodextrin, applied in the directions of glycosyltransferase, transferase, botanical equipment and methods, etc., can solve the problems that limit the large-scale production of AA-2G, the conversion rate is not high, and it is not suitable for AA-2G. 2G and other issues

Active Publication Date: 2016-05-18
JIANGSU CHENGXIN PHARMA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The main problems of using CGTase to produce AA-2G in the prior art are: 1) the thermostability and storage stability of the enzyme are relatively poor, which is not suitable for the production of AA-2G; 2) the conversion rate is not high, and the lower yield limit mass production of the AA-2G

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cyclodextrin glycosyltransferase and its preparation method and application
  • A kind of cyclodextrin glycosyltransferase and its preparation method and application
  • A kind of cyclodextrin glycosyltransferase and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0049] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0050] The experimental instruments, materials and reagents involved in this example are as follows:

[0051] Table 1

[0052]

[0053] Table 2

[0054]

[0055]

Embodiment 1

[0056] Example 1: Thermoanaerobacterium xylanolyticumLX-11 gene DNA

[0057] The CGT sequence of Thermoanaerobacterium xylanolyticum LX-11 strain was obtained from the NCBI publication (SequenceID: ref|YP_004470341.1|), synthesized by Zhongmeitaihe Company. like The amino acid sequence shown in SEQ ID NO: 2 is commercially available.

Embodiment 2

[0058] Example 2: Obtainment of DNA fragment encoding wild-type CGTase

[0059] Primers are designed as follows:

[0060] cgt-F:GGAATTCCATATGAAAAAAACCTTCAAAC

[0061] cgt-R:CGCGGATCCAATCTGCTGCCAGTTAACG

[0062] Using the above primers, the cgt gene was amplified by PCR using the genomic DNA extracted in Example 1 as a template.

[0063] The PCR reaction was carried out in a 50 μl system: PrimeStar DNA polymerase 0.5 μl, 5×PSbuffer 10 μl, 10 mM dNTP 4 μl, upstream and downstream primers 2 μl each, template DNA 1 μl, and water was added to make up to 50 μl.

[0064] The reaction conditions were as follows: denaturation at 94°C for 5 min and then cycling, followed by denaturation at 94°C for 45 s, annealing at 55°C for 15 s, and extension at 72°C for 2 min, for a total of 30 cycles, followed by extension at 72°C for 10 min. Amplification yielded a PCR fragment of about 2100 bp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel cyclodextrin glycosyl transferase and a preparation method and application thereof, wherein the novel cyclodextrin glycosyl transferase is a mutant with the mutation at 55 bit, 77 bit, 121 bit, 331 bit, 543 bit, 604 bit or 615 bit of an amino acid sequence shown in SEQ ID NO:2. The novel cyclodextrin glycosyl transferase has good thermal stability, good storage stability, and high activity, can be used in the production of AA-2G, can increase the yield and improve the conversion rate of vitamin C, and is suitable for large scale production of the AA-2G. By use of the new CGT (cyclodextrin glycosyl transferase), the AA2G yield can reach 170g / L, the conversion rate of vitamin C can reach 55%-60%.

Description

technical field [0001] The invention belongs to the field of genetic engineering and enzyme engineering, and relates to a cyclodextrin glycosyltransferase and a variant thereof for synthesizing AA-2G using β-cyclodextrin and vitamin C as substrates, in particular being derived from Thermoanaerobacterium xylanolyticum LX-11 The CGTase (cyclomaltodextrinlucanotransferase) cyclodextrin glycosyltransferase and its variants. Background technique [0002] Vitamin C is a water-soluble vitamin that the human body cannot synthesize by itself, and plays an important physiological role in the body. However, due to the extreme instability caused by the strong reducibility, its application is greatly limited. Therefore, since the last century, the development of vitamin C derivatives that can not only ensure the normal physiological function of vitamin C but also have better stability is called as a research hotspot. [0003] 2-Oxy-α-D-glucopyranosyl ascorbic acid (AA-2G) is a sacchari...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/60
CPCC12N9/1074C12P19/60C12Y204/01019
Inventor 邢将军
Owner JIANGSU CHENGXIN PHARMA