A method for preventing the inactivation of neurotoxin anntoxin
A neurotoxin and gene technology, applied in the field of molecular biology, can solve the problems of neurotoxin Anntoxin inactivation and toxicity that cannot be effectively targeted at insects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0041] (1) Cloning of neurotoxin Anntoxin gene:
[0042]Using the total RNA extracted from the skin tissue of Hyla huaxie as a template (the method of extracting RNA is the existing conventional TRIzol RNA extraction method), the neurotoxin Anntoxin gene was obtained by RT-PCR amplification reaction; the PCR amplification used The primers were designed as follows: the forward primer was 5' GGATCC ATGAAGACTTCTGTGGTTTTC3' (SEQ ID NO.1) containing a BamHI restriction site,
[0043] The reverse primer is 5' TCTAGATTCTGCTGTCACGCAGGT 3' (SEQ ID NO.2) containing the XbaI restriction site;
[0044] The specific process of RT-PCR amplification reaction is as follows:
[0045] cDNA synthesis: (using a commercially available cDNA synthesis kit)
[0046] Reaction system: extracted total RNA 2 μg
[0047] Oligo(dT) 15 0.5 μl ddH 2 Supplement O to 5 μl, incubate at 70°C for 5 minutes, then place on ice for 5 minutes; 5×buffer 4 μl
[0048] dNTP 1.0μl
[0049] RNase inhibitor 1.0 μl ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com