Supercharge Your Innovation With Domain-Expert AI Agents!

A method for preventing the inactivation of neurotoxin anntoxin

A neurotoxin and gene technology, applied in the field of molecular biology, can solve the problems of neurotoxin Anntoxin inactivation and toxicity that cannot be effectively targeted at insects

Active Publication Date: 2016-09-07
ZHEJIANG MARINE DEV RES INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the problem that the neurotoxin Anntoxin is easily decomposed in the free state of the protein and loses its activity, and the toxicity cannot be effectively targeted at insects. A method for preventing the inactivation of the neurotoxin Anntoxin is provided, and the neurotoxin Anntoxin is embedded in In the polyhedron, the neurotoxin Anntoxin will not be inactivated by the environment, and the activity can be preserved for a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preventing the inactivation of neurotoxin anntoxin
  • A method for preventing the inactivation of neurotoxin anntoxin
  • A method for preventing the inactivation of neurotoxin anntoxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0041] (1) Cloning of neurotoxin Anntoxin gene:

[0042]Using the total RNA extracted from the skin tissue of Hyla huaxie as a template (the method of extracting RNA is the existing conventional TRIzol RNA extraction method), the neurotoxin Anntoxin gene was obtained by RT-PCR amplification reaction; the PCR amplification used The primers were designed as follows: the forward primer was 5' GGATCC ATGAAGACTTCTGTGGTTTTC3' (SEQ ID NO.1) containing a BamHI restriction site,

[0043] The reverse primer is 5' TCTAGATTCTGCTGTCACGCAGGT 3' (SEQ ID NO.2) containing the XbaI restriction site;

[0044] The specific process of RT-PCR amplification reaction is as follows:

[0045] cDNA synthesis: (using a commercially available cDNA synthesis kit)

[0046] Reaction system: extracted total RNA 2 μg

[0047] Oligo(dT) 15 0.5 μl ddH 2 Supplement O to 5 μl, incubate at 70°C for 5 minutes, then place on ice for 5 minutes; 5×buffer 4 μl

[0048] dNTP 1.0μl

[0049] RNase inhibitor 1.0 μl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preventing the inactivation of neurotoxin Anntoxin, aiming at overcoming the problem that neurotoxin Anntoxin is easily decomposed and loses activity in a free protein state, and the toxicity cannot be effectively targeted at insects. The present invention embeds the neurotoxin Anntoxin in the polyhedron, so that the neurotoxin Anntoxin will not be inactivated by the environment, and the activity can be preserved for a long time. In addition, the neurotoxin Anntoxin is embedded in the polyhedron, the polyhedron is easy to be eaten by insects, and the neurotoxin Anntoxin is degraded and released in the insect body, while the polyhedron is stable in reptiles, birds and mammals, and will not Be degraded to release the neurotoxin Anntoxin.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for preventing the inactivation of neurotoxin Anntoxin. Background technique [0002] Anntoxins are a class of gene-encoded neurotoxins produced by tree frogs that are highly lethal to insects, reptiles, birds, and mammals. It can be used to kill agricultural pests, but the protein (Anntoxin) is unstable and easily decomposed in the environment and loses its activity, so it is difficult to be used as a biopesticide. In addition, independent Anntoxin not only has very strong lethal toxicity for insects, but also has strong lethal toxicity for reptiles, birds and mammals, so even if Anntoxin can exist stably, it can be used as a biopesticide, but The toxicity after use is very threatening to various animals and people, so it cannot be applied. [0003] The nuclear polyhedrosis virus in the baculovirus can produce a large amount of polyhedrosis protein in the la...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/866C12N7/01C07K14/435
Inventor 相兴伟章耀周宇芳徐珊杨会成
Owner ZHEJIANG MARINE DEV RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More