Method for regulating volatile oil content of plant by using MicroRNA156 and its target gene

A technology of plant volatile oil and transgenic plants, which is applied in the fields of biotechnology and botany, and can solve the problems of few studies on the transcriptional regulation of volatile oil

Inactive Publication Date: 2014-12-24
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on plant volatile oils mainly focuses on the optimization of extraction process, the analysis of chemical components, and the research on the biological activities of essential oil components. There are few studies on the transcriptional regulation of volatile oil synthesis pathways.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating volatile oil content of plant by using MicroRNA156 and its target gene
  • Method for regulating volatile oil content of plant by using MicroRNA156 and its target gene
  • Method for regulating volatile oil content of plant by using MicroRNA156 and its target gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Example 1, Isolation of Arabidopsis miR156 and SPL10 Genes

[0098] According to the genome sequence information of AT5G26147 (miR156f) on the Arabidopsis Information Resource (TAIR) website, the sequence is (SEQ ID NO: 1): TGGCTAGGGTTTATAGATGTATGTGTATTAAGAGATATGAAACATATTTGTCGACGGTTTGAGTGGTGAGGAATTGATGG TGACAGAAGAGAGTGAG CACACATGGTGGCTTTCTTGCATATTTGAAGGTTCCATGCTTGAAGCTAT GTGTGCTCACTCTCTATCCGTCA CCCCCTTCTCCCCTCTCCCTTCTCTCTCTCTCTCTACAAGCATTTCATTTAGTTTTTAGAGTTAAAACATTTTGATTTTGATTTTTACATCCATTCTTTTGGTTT.

[0099] The primers miR156-F-BamHI and miR156-R-SacI were synthesized, and the Arabidopsis miR156f genome partial sequence was amplified by PCR ( figure 1 A); According to the sequence information of AT1G27370 (SPL10), primers SPL10-F and SPL10-R were synthesized, and the sequence of SPL10 encoding Arabidopsis SQUMOSA PROMOTER BINDING PROTEIN LIKE gene was obtained by PCR amplification. The PCR amplified fragments of miR156f and SPL10 were TA cloned into the pMD18-T v...

Embodiment 2

[0103] The binary vector construction of embodiment 2, miR156f and SPL10 gene

[0104] Firstly, the CaMV35S promoter was amplified with a high-fidelity enzyme, HindIII / PstI sites were introduced at both ends, and then ligated into the corresponding sites of pCAMBIA2301 (Cambia Company) by enzyme digestion to construct pCAMBIA2301-35S. Then the gene fragment of miR156f in the sequenced pMD18-T vector was digested with BamHI and SacI, and then introduced between the multiple cloning sites BamHI and SacI of pCAMBIA2301-35S, thereby obtaining the Pro35S:MIR156f binary vector.

[0105] The miR156 cleavage sequence in SPL10 was mutated (without changing the encoded amino acid species) by two rounds of PCR to form rSPL10 resistant to miR156 cleavage ( figure 1 B and C): The first round of PCR uses high-fidelity enzymes to amplify the fragments on both sides of the mutation site, using the gene fragment of SPL10 in the pMD18-T vector as a template, and the primers are SPL10-F and SPL1...

Embodiment 3

[0113] Example 3, miR156 regulates the synthesis of sesquiterpene in Arabidopsis inflorescence

[0114] Arabidopsis inflorescences release volatile substances, 60% of which are monoterpenes and sesquiterpenes, and sesquiterpenes account for 95% of the volatile terpenes in inflorescences. The synthesis of many terpenoids has time-space specificity. Since miR156 plays an important role in plant growth and development and time-phase transition, the inventors first analyzed the expression of miR156 (Pro35S:MIR156f) by GC-MS (gas chromatography-mass spectrum). ) and simulated miR156 (Pro35S:MIM156) volatile sesquiterpene content in inflorescences.

[0115] Take about 100 inflorescences of Arabidopsis thaliana about 5 weeks old, put them into the micro-pool thermal extraction instrument μ-CTE (pre-balanced temperature and carrier gas) of Markes, UK, and insert the sample collection adsorption tube (Tenax TA, C-T9TNX-2S ), at 42°C, the helium flow rate was 50ml / min, and the extracti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for regulating volatile oil content or sesquiterpene content of plant by using MicroRNA156 and its target gene. The invention for the first time discloses a key gene, a Squamosa promoter binding protein gene (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes, SPLs), for regulating synthesis of volatile oil or sesquiterpenes of plant, and the gene is a target gene for miR156. SPLs directly bonds with a sesquiterpene synthase promoter and activates transcription, and through transgenic technology, it is confirmed that the mechanism plays a role in many plants, so that plants with high yield of plant volatile oil can be obtained based on the method.

Description

technical field [0001] The invention belongs to the fields of biotechnology and botany; more specifically, the invention relates to a method for using MicroRNA156 and its target gene to regulate plant volatile oil or its sesquiterpene content. Background technique [0002] Plant volatile oil (essential oil) is a general term for oily liquids with certain volatility, and is an extract of plant aromatic substances. There are many Chinese herbal medicines containing volatile oil, and many of them have aromatic smells, especially Lamiaceae (mint, perilla, Huoxiang, etc.), Umbelliferae (fennel, angelica, coriander, Angelica dahurica, Chuanxiong, etc.), Compositae (artemisia argyi, Capillary, Atractylodes, Atractylodes, Woody, etc.), Rutaceae (orange, tangerine, pepper, etc.), Lauraceae (camphorae, cinnamon, etc.), Zingiberaceae (ginger, turmeric, turmeric, etc.) and other families are more abundant. The composition of plant volatile oil is complex, mainly composed of terpenoids,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/113C12N15/82C07K14/415A01H5/00
Inventor陈晓亚于宗霞王凌健王佳伟
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI