Feline long-acting fusion interferon and its preparation method and application
A technology of interferon and fusion protein, applied in biochemical equipment and methods, chemical instruments and methods, and methods based on microorganisms, etc., can solve complex problems, achieve product cost reduction, improve therapeutic effect, and simple protein purification process Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Preparation of dog and cat long-acting fusion interferon
[0028] CSA, FSA, cIFN, and fIFN were used to construct recombinant dog and cat serum albumin-interferon fusion protein expression vectors.
[0029] Preparation steps of dog and cat serum albumin-interferon fusion protein:
[0030] 1. Refer to the open reading frame of canine serum albumin (CSA) gene (NM_001003026.1) and cat serum albumin (FSA) gene (NM_001009961.1) and the physical map of yeast expression vector pPIC3.5k to design primers and introduce restriction sites In the meantime, the natural signal peptide of serum albumin is retained, the stop codon of serum albumin is removed, and the signal peptide of interferon and the start codon are removed.
[0031] (1) CSA upstream primer:
[0032] CSA1:
[0033] 5`-GC GAATTC GCCATGAAGTGGGTAACTTTTATTTCCCTC TTCTTTC-3`, where the 5` end contains EcoRI restriction site;
[0034] CSA downstream primer:
[0035] CSA2:
[0036] 5`- TAGGATCCACCACCACCG ACTAAGGCAGCTTGAGCAG ...
Embodiment 2
[0080] Example 2 Detection of activity of dog and cat long-acting fusion interferon
[0081] 1. In vitro biological activity detection: the in vitro biological activity of dog and cat long-acting fusion interferon was detected by WISH-VSV microcytopathic inhibition method, and the cell count was 2.5×105~3.5×105 cells / ml WISH cell suspension Seed on 96-well cell plate, 100μl per well, 37℃, 5% CO 2 Cultivate for 4-6h under conditions. Prepare complete culture medium: 10% bovine serum MEM, assay culture medium: 7% bovine serum MEM, challenge culture medium: 3% bovine serum MEM. Dilute the standard sample to 103IU / ml with the assay culture solution, and then dilute the standard sample diluent and the induced culture supernatant to be tested at a 4-fold ratio, to a total dilution of 412 times. Add the positive control standard diluted multiple times and the induced culture supernatant to be tested into a 96-well plate that has been plated with WISH cells according to the correspondin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



