Bemisia tabaci C-type lysozyme Btlys-c gene as well as preparation and application of encoded protein

A gene encoding, lysozyme technology, applied in the field of molecular biology and genetic engineering, can solve the problems of plant virus disease pandemic, crop yield reduction or failure, plant wilting and other problems

Active Publication Date: 2015-04-08
ZHEJIANG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The insect not only feeds on a large amount of plant juice, causing the plants to wither, but also spreads a variety of plant viruses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bemisia tabaci C-type lysozyme Btlys-c gene as well as preparation and application of encoded protein
  • Bemisia tabaci C-type lysozyme Btlys-c gene as well as preparation and application of encoded protein
  • Bemisia tabaci C-type lysozyme Btlys-c gene as well as preparation and application of encoded protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment example 1

[0026] Implementation Case 1: Full-length cDNA Cloning of Bemisia tabaci Type C Lysozyme (Btlys-c) Gene

[0027] 1.1, TRIzol method to extract total RNA

[0028] (1) Freeze a certain amount (200 Bemisia tabaci) for 1 min, put it into a 1.5 ml centrifuge tube, add 1 ml TRIzol reagent, thoroughly grind and homogenate, and let stand at room temperature for 5 min.

[0029] (2) Add 0.2ml chloroform to the centrifuge tube, shake for 15s, transfer the mixture into a TIANGEN centrifuge tube, and let stand for 2min.

[0030] (3) Centrifuge at 12000g for 15min at 4°C, take the supernatant, and transfer it to a new 1.5ml centrifuge tube.

[0031] (4) Add 0.5ml of isopropanol to the centrifuge tube, mix the liquid in the tube gently, and let stand at room temperature for 10 minutes.

[0032] (5) Centrifuge at 12000 g for 10 min at 4°C, and discard the supernatant.

[0033] (6) Add 1ml of 75% ethanol to the centrifuge tube, gently wash the precipitate, centrifuge at 7500g for 5min at 4°...

Embodiment 2

[0050] Embodiment 2: Bemisia tabaci type C lysozyme (Btlys-c) gene expression vector construction, expression and functional activity assay

[0051] 2.1. Expression vector construction

[0052] (1) According to the sequence of Bemisia tabaci type C lysozyme (Btlys-c) gene and the cloning site of expression vector pET-28a (Novagen Company), design primers: Btlysc-BamH: CG GGATCC GTCTTCAACAAGTGCGAGC (BamHI site is underlined); Btlysc–Xho I: CC GCTCG AGTTAGCAGCCGTTGGTGAATC (Xho I site is underlined).

[0053] (2) Gene amplification, cloning and recombinant plasmid screening

[0054] Using the whitefly dsDNA as a template, the PCR reaction was carried out with the above primers. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 15s, 63°C, 30s, 72°C, 45s, 35 cycles; 72°C, 6min extension .

[0055] Take 2 μl of PCR products, and after detection by 1% agarose gel electrophoresis, the Clean UP kit cleans and recovers the PCR products. Using the PET-28a plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical fields of molecular biology and genetic engineering, and aims at providing a bemisia tabaci C-type lysozyme Btlys-c gene as well as a preparation and an application of an encoded protein. A nucleotide sequence of the bemisia tabaci C-type lysozyme (Btlys-c) gene is as shown in SEQ ID NO.1. The the bemisia tabaci C-type lysozyme Btlys-c gene provided by the invention and the encoded nucleotide sequence thereof can be applied to expression of new protein and encoded sequence in escherichia coli; the result of a bacteriostasis experiment after purification of a recombinant protein with antibacterial activity proves that the recombinant protein for prokaryotic expression of the recombinant bemisia tabaci C-type lysozyme (Btlys-c) gene has the ability of resisting gram-positive bacterium; and furthermore, the bemisia tabaci C-type lysozyme Btlys-c gene is produced through an existing genetic engineering method by using the method disclosed by the invention, and has potential application value in the aspects such as development of antibacterial drugs, food preservatives and feed additives.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and genetic engineering. The invention relates to a Bemisia tabaci lysozyme (Lysozyme) gene and the application of the encoded protein thereof, in particular to an in vitro recombinant expression technology of the Bemisia tabaci lysozyme (Lysozyme), separation and purification of active recombinant proteins, and antimicrobial effects on microorganisms Effect research. Background technique [0002] Lysozyme (Lysozyme) is a hydrolytic enzyme that specifically acts on the cell wall of microorganisms, also known as cell wall lytic enzyme. Discovered by Flemming in 1922, it widely exists in eukaryotes and prokaryotes, and can cut off the β-1,4 glycoside between N-hexanoylglucosamine and N-hexanoylmuramic acid in peptidoglycan bond, causing cell lysis. According to the primary structure, molecular weight and biological source of lysozyme, lysozyme can be divided into six types, namely: pha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/56C12N9/36C12N15/70A61K38/47A61P31/00A61P37/02A23K1/165
Inventor 陈学新王知知时敏
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap