Bemisia tabaci C-type lysozyme Btlys-c gene as well as preparation and application of encoded protein
A gene encoding, lysozyme technology, applied in the field of molecular biology and genetic engineering, can solve the problems of plant virus disease pandemic, crop yield reduction or failure, plant wilting and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment example 1
[0026] Implementation Case 1: Full-length cDNA Cloning of Bemisia tabaci Type C Lysozyme (Btlys-c) Gene
[0027] 1.1, TRIzol method to extract total RNA
[0028] (1) Freeze a certain amount (200 Bemisia tabaci) for 1 min, put it into a 1.5 ml centrifuge tube, add 1 ml TRIzol reagent, thoroughly grind and homogenate, and let stand at room temperature for 5 min.
[0029] (2) Add 0.2ml chloroform to the centrifuge tube, shake for 15s, transfer the mixture into a TIANGEN centrifuge tube, and let stand for 2min.
[0030] (3) Centrifuge at 12000g for 15min at 4°C, take the supernatant, and transfer it to a new 1.5ml centrifuge tube.
[0031] (4) Add 0.5ml of isopropanol to the centrifuge tube, mix the liquid in the tube gently, and let stand at room temperature for 10 minutes.
[0032] (5) Centrifuge at 12000 g for 10 min at 4°C, and discard the supernatant.
[0033] (6) Add 1ml of 75% ethanol to the centrifuge tube, gently wash the precipitate, centrifuge at 7500g for 5min at 4°...
Embodiment 2
[0050] Embodiment 2: Bemisia tabaci type C lysozyme (Btlys-c) gene expression vector construction, expression and functional activity assay
[0051] 2.1. Expression vector construction
[0052] (1) According to the sequence of Bemisia tabaci type C lysozyme (Btlys-c) gene and the cloning site of expression vector pET-28a (Novagen Company), design primers: Btlysc-BamH: CG GGATCC GTCTTCAACAAGTGCGAGC (BamHI site is underlined); Btlysc–Xho I: CC GCTCG AGTTAGCAGCCGTTGGTGAATC (Xho I site is underlined).
[0053] (2) Gene amplification, cloning and recombinant plasmid screening
[0054] Using the whitefly dsDNA as a template, the PCR reaction was carried out with the above primers. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 15s, 63°C, 30s, 72°C, 45s, 35 cycles; 72°C, 6min extension .
[0055] Take 2 μl of PCR products, and after detection by 1% agarose gel electrophoresis, the Clean UP kit cleans and recovers the PCR products. Using the PET-28a plasm...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com