Recombined streptomycete, construction method thereof and method for increasing antibiotic yield
A technology of Streptomyces and mold, applied in the field of genetic engineering, can solve the problems of low fermentation unit and high production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1, the construction of ilvH gene expression vector
[0041] 1. Amplification of ilvH structural gene
[0042] Primers were designed for amplifying the ilvH structural gene [NC_003155.4 (3353885..3354412)] located on the chromosome of Streptomyces avermitilis MA4680 (ATCC31267), that is, sequence 1 in the sequence listing.
[0043] Upstream primer Primer F1: ATGAGCAAGCACACCCTCTCCGTCCT,
[0044] Downstream primer Primer R1: TTGTAAAACGACGGCCAGT GAATTC TTACGCGGATCGGTCCAGCGCGCGC,
[0045] The underlined base is the recognition site of the restriction endonuclease EcoRI, and the amplified product should be 557bp.
[0046] Using the total DNA of Streptomyces avermitilis MA4680 (ATCC31267) as a template, Primer F1 and Primer R1 as primers, the Q5Hot Start High-Fidelity DNA Polymerase of New England Biolabs was used to perform PCR amplification, and the amplification conditions were 98°C, 3min; (98°C, 10s; 72°C, 40s)×30 cycles; 72°C, 2min. The amplified product ...
Embodiment 2
[0055] Embodiment 2, transformation of recombinant plasmid
[0056] Due to the strong restriction modification in Streptomyces abamectin, if E.coli DH5α is directly combined with Streptomyces abamectin for transfer, the transformation efficiency is extremely low, and sometimes even no transformant can be obtained. However, the conversion efficiency was significantly improved when E.coli ET12567 (PUZ8002) was used for binding transfer without restriction modification. Therefore, the constructed recombinant plasmid was transformed into E.coli ET12567 (PUZ8002) (Kieser T, Bibb M J, Buttner M J, et al. Practical Streptomyces Genetics, 2000, Norwich: The John Innes Foundation.) to obtain non-methyl liquefied DNA, followed by conjugation transfer.
[0057] In this example, Streptomyces avermitilis MA4680 (ATCC31267) was selected as the starting strain, which produces off-white spores on the plate.
[0058] The E.coli ET12567 (PUZ8002) containing the ilvH gene expression plasmid pH...
Embodiment 3
[0060] Embodiment 3, the fermentation research of recombinant bacterial strain
[0061] 1. Shake flask fermentation of abamectin streptomyces
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
