Supercharge Your Innovation With Domain-Expert AI Agents!

Recombined streptomycete, construction method thereof and method for increasing antibiotic yield

A technology of Streptomyces and mold, applied in the field of genetic engineering, can solve the problems of low fermentation unit and high production cost

Active Publication Date: 2015-04-22
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production strain of Abamectin also has low fermentation units and high production costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined streptomycete, construction method thereof and method for increasing antibiotic yield
  • Recombined streptomycete, construction method thereof and method for increasing antibiotic yield
  • Recombined streptomycete, construction method thereof and method for increasing antibiotic yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the construction of ilvH gene expression vector

[0041] 1. Amplification of ilvH structural gene

[0042] Primers were designed for amplifying the ilvH structural gene [NC_003155.4 (3353885..3354412)] located on the chromosome of Streptomyces avermitilis MA4680 (ATCC31267), that is, sequence 1 in the sequence listing.

[0043] Upstream primer Primer F1: ATGAGCAAGCACACCCTCTCCGTCCT,

[0044] Downstream primer Primer R1: TTGTAAAACGACGGCCAGT GAATTC TTACGCGGATCGGTCCAGCGCGCGC,

[0045] The underlined base is the recognition site of the restriction endonuclease EcoRI, and the amplified product should be 557bp.

[0046] Using the total DNA of Streptomyces avermitilis MA4680 (ATCC31267) as a template, Primer F1 and Primer R1 as primers, the Q5Hot Start High-Fidelity DNA Polymerase of New England Biolabs was used to perform PCR amplification, and the amplification conditions were 98°C, 3min; (98°C, 10s; 72°C, 40s)×30 cycles; 72°C, 2min. The amplified product ...

Embodiment 2

[0055] Embodiment 2, transformation of recombinant plasmid

[0056] Due to the strong restriction modification in Streptomyces abamectin, if E.coli DH5α is directly combined with Streptomyces abamectin for transfer, the transformation efficiency is extremely low, and sometimes even no transformant can be obtained. However, the conversion efficiency was significantly improved when E.coli ET12567 (PUZ8002) was used for binding transfer without restriction modification. Therefore, the constructed recombinant plasmid was transformed into E.coli ET12567 (PUZ8002) (Kieser T, Bibb M J, Buttner M J, et al. Practical Streptomyces Genetics, 2000, Norwich: The John Innes Foundation.) to obtain non-methyl liquefied DNA, followed by conjugation transfer.

[0057] In this example, Streptomyces avermitilis MA4680 (ATCC31267) was selected as the starting strain, which produces off-white spores on the plate.

[0058] The E.coli ET12567 (PUZ8002) containing the ilvH gene expression plasmid pH...

Embodiment 3

[0060] Embodiment 3, the fermentation research of recombinant bacterial strain

[0061] 1. Shake flask fermentation of abamectin streptomyces

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombined streptomycete, a construction method of the recombined streptomycete and a method for increasing the antibiotic yield. The recombined streptomycete over-expresses acetolactic acid synthase small subunit ilvH. The recombined streptomycete over-expresses acetolactic acid synthase to adjust subunit genes, and the yield of products such as antibiotics for conducting secondary metabolism with L-isoleucine and / or L-valine and / or L-leucine as precursors / a precursor can be remarkably increased.

Description

technical field [0001] The invention belongs to the field of genetic engineering, relates to a recombinant streptomyces and its application, in particular to improving the output of antibiotics by transforming key genes in the synthetic pathway of antibiotic precursors. Background technique [0002] Streptomyces is a Gram-positive actinomycete, which belongs to the genus Streptomyces (Strptomyces) in systems biology, and has a complex life cycle and secondary metabolic pathways. Many members of this genus produce a variety of biologically active secondary metabolites. Among the tens of thousands of known antibiotics, more than 70% are produced by Streptomyces. In addition, it can also produce immunosuppressants, antineoplastic agents, insecticides and a variety of extracellular hydrolytic enzymes, such as cellulase, amylase, pectinase and protease. [0003] In the process of Streptomyces producing secondary metabolites, amino acids can be used as carbon sources and nitroge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/76C12N15/60C12P19/62C12R1/465
CPCC12N9/88C12P19/623
Inventor 张立新刘钇君刘梅朱华张庆高鹤永刘新利帅辉唐丹
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More