Cas9-scForkI fusion protein and application thereof

A cas9-scforki, 1.cas9-scforki technology, applied in the field of molecular biology, can solve the problems of complex design and low cutting efficiency, and achieve the effect of flexible design, high cutting activity and high efficiency

Inactive Publication Date: 2015-04-22
SUZHOU KECHUANG BIOTECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two technologies need to design two gRNA targets, and the design is more complicated.
Moreover, the cutting efficiency of Cas9-ForkI nickase is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9-scForkI fusion protein and application thereof
  • Cas9-scForkI fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Preparation of Cas9-scForkI fusion protein

[0024] The preparation method of described Cas9-scForkI fusion protein comprises steps as follows:

[0025] The first part, the construction of pCas9-scForkI eukaryotic expression vector:

[0026] Synthetic Cas9-ForkI-(Gly-Gly-Gly-Gly-Ser) 10-ForkI DNA sequence shown in SEQ ID NO.8, with Cas9-ForkI-(Gly-Gly-Gly-Gly-Ser) 10-ForkI DNA Sequence as template, using primer Primer_F1: CAGCCTCCGGACTCTAGAGCCACCATGGACAAGAAGTACTC (SEQ ID NO.3) and primer_R1: AACTCATTACTAACCGGTTCATGAGCGGAAATTGATCTCGC (SEQ ID NO.4)

[0027] For amplification, configure the reaction system as shown in Table 1:

[0028] Table 1 Reaction system

[0029] 5×primerSTAR Buffer 10 ul dNTPs (2.5 mM) 4μl TaKaRa Taq HS (5 U / μl) 0.5ul Primer_F1 20pmol 1ul Primer_R1 20pmol 1ul Cas9-ForkI-(Gly-Gly-Gly-Gly-Ser)10-ForkI (20ng / ul) 1ul ddH2O 32.5 ul total 50 ul

[0030] Amplification reaction program...

Embodiment 2

[0041] Example 2 Verification of Cas9-scForkI protein cleavage activity

[0042] Cas9-scForkI protein (300 nM) was mixed with linearized plasmid pDNA3.1, tracrRNA, Mg 2+ , and incubated with different components of crRNA. Discovery of Cas9-scForkI protein with linearized plasmid pDNA3.1, tracrRNA, Mg 2+, gRNA incubated this group, DNA has cutting activity. It shows that Cas9-scForkI protein (300 nM) is active.

[0043] The details are as follows: tracrRNA and crRNA transcribed in vitro were denatured at 95°C, and then slowly cooled to room temperature. Combine Cas9-scForkI protein with linearized and non-linearized plasmid pDNA3.1 (200 ng), Mg 2+ , tracrRNA (100 nM), and crRNA (100 nM) components were incubated at 37°C for one hour. The reaction buffer is: 20 mM HEPES pH 7.5, 150 mM KCl, 0.5 mM DTT, 0.1 mM EDTA, 10 mM MgCl 2 . After reacting for one hour, add 5X SDS loading buffer (30% glycerol, 1.2% SDS, 250 mM EDTA) for electrophoresis. The result shows as figure...

Embodiment 3

[0044] Example 3 Verification of Cas9-scForkI protein cutting activity on Malt1 gene

[0045] The Cas9-scForkI eukaryotic expression vector and the gRNA targeting the Malt1 gene: AACTGTGCTGCCGGGCAAC (SEQ ID NO.5) were electrotransfected into mouse ES cells. After 24 hours of electrotransfection, clones were picked and cultured in 96-well plates. After the cells are confluent, add 47.5 ul ES cell lysate and 2.5 ul 10 mg / ml proteinase K to each well, and place the plate in a 56 oC incubator for overnight digestion. On the next day, prepare a mixture of 10 ml of pre-cooled absolute ethanol + 150 ul of 5M NaCl per plate, let it stand at room temperature for 2 hrs, let the DNA precipitate, centrifuge, and elute to obtain mouse ES cell genomic DNA. The cell lysate formula is: Tris-HCl pH 7.5 (10 mM), EDTA pH 8.0 (10 mM), NaCl (10 mM), 1% SDS. Amplify with Primer F: TGCTTTACAAAGTTTCCAGCTGAAG (SEQ ID NO.6) and Primer R: AACCAACCAACCAACCAGCTAA (SEQ ID NO.7), and configure the react...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Cas9-scForkI fusion protein and application thereof, and belongs to the field of molecular biology. According to the Cas9-scForkI fusion protein and application, an inactivate Cas9 protein is transformed through a genetic engineering method; (G4S)10, namely (Gly-Gly-Gly-Gly-Ser)10, serves as a linker to be used for connecting two ForkIs; the ForkIs and the inactivate Cas9 are fused into Cas9-scForkI; and according to the Cas9-scForkI fusion protein, genomic editing can be carried out through sequence specificity. When the Cas9-scForkI fusion protein is used for drug screening or gene modification, more safety is obtained; and the fusion protein can further be used for gene treatment. Compared with the prior art, the design is more flexible; the cutting activation is higher; the input efficiency is higher when the fusion protein serves as a gene; and the fusion protein can be used for gene modification or gene treatment.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a Cas9-scForkI fusion protein and an application thereof. Background technique [0002] CRISPR-Cas is derived from the immune system of bacteria and archaea, and can use target-specific RNA to bring Cas9 nuclease to specific targets on the genome, thereby modifying specific genetic loci. RNA-guided Cas9 can function in a variety of cells and organisms, cleaving entire genomes at specific sites. The genome editing potential of Cas9 has made this technology widely used in human cell lines, mice, rats, gene knockout and knockin in multiple species. [0003] ForkI is a restriction endonuclease, and ForkI can cut DNA after dimerization. It has been reported in the literature that inactivated Cas9 is fused with ForkI, that is, Cas9-ForkI can be used for genome editing. Moreover, Cas9-Forkl nickase can be more precisely used for genome editing. However, these t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/62
CPCC12N9/22C07K2319/00
Inventor李云英
OwnerSUZHOU KECHUANG BIOTECH