Application of miR319a2 in adjustment of head shape of cabbage leaf
A technology of RNA-mir319a2 and cabbage, which is applied in the application field of adjusting the shape of cabbage leaf balls, and can solve the problem that the effect cannot be underestimated.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Brp-miR319a2 alters Chinese cabbage leaf ball shape
[0083] In the course of long-term research, the present inventors discovered a specific variety of Chinese cabbage whose leaf bulbs are approximately round.
[0084] Through the genome resequencing and RNA sequencing of Chinese cabbage varieties, the inventors discovered a miR319a family member with a point mutation in the genome sequence of head cabbage (Bre), and the new member was named Brp-MIR319a2 (abbreviated as Brp-MIR319a2). "miR319a2"), the sequence of which is as SEQ ID NO.: 1 and figure 1 shown.
[0085] Compared with miR319a, the Brp-MIR319a2 gene has a G→A nucleotide point mutation ( figure 1 ), the mutation resulted in enhanced complementarity between miR319a2 and Chinese cabbage target genes (BrpTCPs) sequences, resulting in reduced BrpTCP gene expression levels (compared to Chinese cabbage expressing wild-type miR319a only).
[0086] The point mutation was discovered for the first time and has not ...
Embodiment 2
[0089] Mutations in the target gene BrpTCP also lead to similar changes in leaf ball shape
[0090] The leaf balls of headed cabbage can be divided into four types: round, oval, flat and cylindrical ( figure 2 A-2H). Heading cabbage (Bre) has a round leaf ball ( figure 2 I, 2J). Heading cabbage Bre (purchased from the Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) and non-heading cabbage (Wu-11) (purchased from the Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were crossed, Self-pollination started from the first generation of hybridization and continued for 6 generations to obtain almost homozygous F6 generation recombinant inbred lines. In the observation of the shape of the leaf ball, it was found that among the lines of the F6 generation, a total of 58 lines could form a leaf ball, and the formed leaf ball had the above-mentioned...
Embodiment 3
[0094] Transfection of miR319a2 alters leaf bulb shape
[0095] In this example, the 834 bp genomic fragment of Brp-MIR219a2 (SEQ ID NO.: 3) was inserted into the pCAMBIA3301 vector (purchased from CAMBIA, Australia) and driven by the CaMV35S promoter.
[0096] Methods as below:
[0097] Using the Brp-MIR319a2 gene-specific primers, the primer sequences are as follows:
[0098] BrpMIR319a2-S: CCCAAGGAGTTTGCAACTACG (SEQ ID NO.: 4),
[0099] BreMIR319a2-A:GGTGACACGCCAGCTTGAA (SEQ ID NO.:5),
[0100] Using the genomic DNA of Bre cabbage (purchased from the Institute of Plant Physiology and Ecology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences) extracted by conventional methods as the template, a fragment of 834 bp in length was amplified by PCR, and the 834 bp fragment was amplified by the restriction endonuclease BamHI and It was digested with SalI, constructed into the commercial pCAMBIA3301 vector, and driven by the cauliflower mosaic virus promot...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More