Glutathione production method
A technology of glutathione and cysteine, which can be used in the biological field to solve problems such as low yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Embodiment 1, the construction of the single-enzyme expression strain that produces glutathione (GSH)
[0070] 1. Construction of pET24a-SAG
[0071] According to the reported gene sequence of glutathione bifunctional enzyme SAG derived from Streptococcus agalactiae (NCBI accession number: AE009948.1), the sequence was synthesized from the entire gene, and restriction sites NdeI and HindIII were designed at both ends, and subcloned into the vector pET24a (purchased from Novagen) at the corresponding site to obtain the recombinant plasmid pET24a-SAG, see the plasmid map figure 1 .
[0072] The constructed recombinant plasmid pET24a-SAG was transformed into Escherichia coli expression host BL21(DE3) by calcium chloride method to obtain BL21(DE3) / pET24a-SAG.
[0073] 2. Construction and expression of pET24a-STH
[0074] According to the reported gene sequence of the glutathione bifunctional enzyme STH derived from Streptococcus thermophilus strain SIIM B218 (NCBI access...
Embodiment 2
[0132] Embodiment 2, the construction of the combined enzyme expression strain that produces GSH
[0133] 1. Construction of STH and gshB-ack co-expression strains
[0134] (1) Construction of pMWK-gshB-ack
[0135] Using the plasmid pPIC3.5K (purchased from Invitrogen) as a template, the primers were designed as follows: Kandn: CCAACCAATTAACCAATTCTGATTAG (SEQ ID NO: 10), Kanup: CCTGCAGGGGGGGGGGGAAAGCCACGTTGTGTC (SEQ ID NO: 11), and a 0.9 kb Kan fragment was amplified by PCR. The PCR reaction system includes: 0.3μM each primer, 50ng template, 1×KODneo plus buffer, 0.2mM dNTP, 1.5mM MgSO 4 , KOD neo plus1U, add ddH2O to the total system 50μL. The temperature conditions are: 94°C for 2min; 98°C for 10s, 55°C for 30s, 68°C for 30s, repeating 30 cycles; 68°C for 10min. After the PCR reaction was completed, the agarose gel electrophoresis was used to identify the kan fragment, and the gel recovery kit recovered the kan fragment. Plasmid pMW118 (purchased from Nippon Gene, Toyam...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap