Application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1
A fatty alcohol synthesis, enzyme gene technology, applied in the application, genetic engineering, enzymes and other directions, can solve the problems of low efficiency, time-consuming and laborious, and achieve the effect of prolonging the preservation time and enhancing the drought resistance of plants.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Embodiment 1: Experiment of cultivating the Saccharomyces cerevisiae strain producing ultra-long-chain fatty alcohol
[0014] 1. Cloning of the TaFAR1 gene: The sequence information of the FAR gene was obtained from the NCBI database, and the cDNA of the leaves of the wheat variety Ming 988 at the seedling stage was used as a template, and the primers were designed as follows:
[0015] TaFAR1(F): 5'ATGGTGGGCACGCTGGATGAGG 3', as shown in SEQ ID No: 2;
[0016] TaFAR1(R): 5'TCACTTGAGGACGTACTTCATG 3', as shown in SEQ ID No: 3;
[0017] The PCR reaction system is: in a 50 μl reaction system, it contains 5 μl of DNA template, 2.5 μl of upstream and downstream primers, 10 μl of dNTP, 25 μl of Buffer, 1 μl of KOD polymerase, ddH 2 O4μl; PCR reaction program: pre-denaturation at 94°C for 2min; denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 68°C for 2min, and a total of 35 cycles; extension at 68°C for 10min, storage at 10°C; RT-PCR amplification, PCR Af...
Embodiment 2
[0021] Embodiment 2: Drought resistance experiment of plants transfected with TaFAR1 gene
[0022] 1. Cloning of TaFAR1 gene: same as Example 1.
[0023] 2. Construction of TaFAR1 gene expression vector: After recovering and purifying the PCR amplification product, connect it to the plant expression binary vector pCXSN driven by the 35S promoter to obtain the fusion expression vector TaFAR1-pCXSN, transform E. coli DH5α, and select positive clones for sequencing confirmation.
[0024] 3. Obtaining plants expressing the TaFAR1 gene: extracting the plasmid, transforming it into the Agrobacterium EHA105, transforming the wheat variety Xinong 979 through the Agrobacterium-mediated method, and obtaining the transgenic plants transfected with the TaFAR1 gene. Use the SDS method to extract the DNA of transgenic plants, the specific steps are as follows: (1) Take half to one leaf (leaves stored at -80°C), and grind liquid nitrogen powder with liquid nitrogen in a pre-cooled mortar at ...
Embodiment 3
[0026] Embodiment 3: the fresh-keeping experiment of the fruit of transfecting TaFAR1 gene
[0027] 1. Cloning of TaFAR1 gene: same as Example 1.
[0028] 2. Construction of TaFAR1 gene expression vector: the same as in Example 2.
[0029]3. Obtain the fruit expressing the TaFAR1 gene: transfer the confirmed recombinant expression vector TaFAR1-pCXSN into Agrobacterium GV3101, transform the tomato variety MicroTom through the Agrobacterium-mediated transformation method, obtain the transgenic plants with the TaFAR1 gene, and use the SDS method to extract the transgene The DNA of the plant, the specific steps are as follows: (1) Take half to one leaf (leaves stored at -80°C), grind it with liquid nitrogen in a pre-cooled mortar at -20°C to obtain 1 / 3 to 1 / 2 tubes; (2) Add 600 μl SDS extract and shake well, incubate at 65°C for 30 minutes, shake occasionally for 3-4 times, incubate until the sample solution turns dark green; (3) Add 100 μl 5M KAC (1 / 4 volume), shake After hom...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 