Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1

A fatty alcohol synthesis, enzyme gene technology, applied in the application, genetic engineering, enzymes and other directions, can solve the problems of low efficiency, time-consuming and laborious, and achieve the effect of prolonging the preservation time and enhancing the drought resistance of plants.

Inactive Publication Date: 2015-05-20
NORTHWEST A & F UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, it is time-consuming, laborious, and inefficient to improve the drought resistance and fruit freshness of plants through artificial breeding of new varieties; on the contrary, overexpressing wax synthesis genes through transgenic technology can increase the wax content of plant epidermis and improve The drought resistance of plants and the preservation of fruits are convenient and fast

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1
  • Application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1
  • Application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Embodiment 1: Experiment of cultivating the Saccharomyces cerevisiae strain producing ultra-long-chain fatty alcohol

[0014] 1. Cloning of the TaFAR1 gene: The sequence information of the FAR gene was obtained from the NCBI database, and the cDNA of the leaves of the wheat variety Ming 988 at the seedling stage was used as a template, and the primers were designed as follows:

[0015] TaFAR1(F): 5'ATGGTGGGCACGCTGGATGAGG 3', as shown in SEQ ID No: 2;

[0016] TaFAR1(R): 5'TCACTTGAGGACGTACTTCATG 3', as shown in SEQ ID No: 3;

[0017] The PCR reaction system is: in a 50 μl reaction system, it contains 5 μl of DNA template, 2.5 μl of upstream and downstream primers, 10 μl of dNTP, 25 μl of Buffer, 1 μl of KOD polymerase, ddH 2 O4μl; PCR reaction program: pre-denaturation at 94°C for 2min; denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 68°C for 2min, and a total of 35 cycles; extension at 68°C for 10min, storage at 10°C; RT-PCR amplification, PCR Af...

Embodiment 2

[0021] Embodiment 2: Drought resistance experiment of plants transfected with TaFAR1 gene

[0022] 1. Cloning of TaFAR1 gene: same as Example 1.

[0023] 2. Construction of TaFAR1 gene expression vector: After recovering and purifying the PCR amplification product, connect it to the plant expression binary vector pCXSN driven by the 35S promoter to obtain the fusion expression vector TaFAR1-pCXSN, transform E. coli DH5α, and select positive clones for sequencing confirmation.

[0024] 3. Obtaining plants expressing the TaFAR1 gene: extracting the plasmid, transforming it into the Agrobacterium EHA105, transforming the wheat variety Xinong 979 through the Agrobacterium-mediated method, and obtaining the transgenic plants transfected with the TaFAR1 gene. Use the SDS method to extract the DNA of transgenic plants, the specific steps are as follows: (1) Take half to one leaf (leaves stored at -80°C), and grind liquid nitrogen powder with liquid nitrogen in a pre-cooled mortar at ...

Embodiment 3

[0026] Embodiment 3: the fresh-keeping experiment of the fruit of transfecting TaFAR1 gene

[0027] 1. Cloning of TaFAR1 gene: same as Example 1.

[0028] 2. Construction of TaFAR1 gene expression vector: the same as in Example 2.

[0029]3. Obtain the fruit expressing the TaFAR1 gene: transfer the confirmed recombinant expression vector TaFAR1-pCXSN into Agrobacterium GV3101, transform the tomato variety MicroTom through the Agrobacterium-mediated transformation method, obtain the transgenic plants with the TaFAR1 gene, and use the SDS method to extract the transgene The DNA of the plant, the specific steps are as follows: (1) Take half to one leaf (leaves stored at -80°C), grind it with liquid nitrogen in a pre-cooled mortar at -20°C to obtain 1 / 3 to 1 / 2 tubes; (2) Add 600 μl SDS extract and shake well, incubate at 65°C for 30 minutes, shake occasionally for 3-4 times, incubate until the sample solution turns dark green; (3) Add 100 μl 5M KAC (1 / 4 volume), shake After hom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of wheat overlong chain fatty alcohol synthetase gene TaFAR 1, including application in plant breeding, application in improving drought resistant ability of plants and retaining freshness of fruits, and application in synthesizing overlong chain fatty alcohol in yeast strains. The wheat overlong chain fatty alcohol synthetase gene TaFAR 1 provided in the invention has a nucleotide sequence shown as SEQ ID NO:1. Through transgene expression, the yeast expressing the TaFAR 1 gene can be fermented to produce overlong chain fatty alcohol, and plants overexpressing the TaFAR 1 gene have significantly enhanced drought resistance, and the produced fruits can retain freshness for a prolonged period.

Description

technical field [0001] The invention relates to the application of a wheat ultra-long-chain fatty alcohol synthase gene TaFAR1. Background technique [0002] Epidermal wax is the outermost protective substance covering the surface of plants. The composition of plant leaf epidermal wax is complex and is generally considered to be a mixture of organic substances. With the help of gas chromatography-mass spectrometry, researchers found that the main components are long-chain Fatty acids, alcohols, aldehydes, esters and n-alkanes. The composition and form of wax on the leaf surface of plants vary in different species, in different growth stages of the same species, and even in different varieties of the same species. The abiotic factors outside the plant often affect the synthesis and secretion of its epidermal wax, and the wax composition will change due to various water, drought stress, ozone, acid mist, water washing and pollutants. According to the results of the study, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/82A01H5/00C12N15/81
CPCC12N9/1025C12N15/8247C12N15/8249C12N15/8273
Inventor 王中华汪勇王美玲孙瑜琳柴乖强
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com