Unlock instant, AI-driven research and patent intelligence for your innovation.

Insect chitin deacetylate enzyme genes 1 and application of insect chitin deacetylate enzyme genes 1 in pest control

A technology of acetylase and chitin, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of drug resistance, non-target biological hazards, environmental pollution, etc., and achieve the effect of high lethality

Active Publication Date: 2015-05-20
SHANXI XINYUAN HUAKANG CHEM
View PDF7 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term application of chemical insecticides leads to a series of problems, such as environmental pollution, resistance development and harm to non-target organisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insect chitin deacetylate enzyme genes 1 and application of insect chitin deacetylate enzyme genes 1 in pest control
  • Insect chitin deacetylate enzyme genes 1 and application of insect chitin deacetylate enzyme genes 1 in pest control
  • Insect chitin deacetylate enzyme genes 1 and application of insect chitin deacetylate enzyme genes 1 in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1: Acquisition of full-length cDNA sequence of migratory locust chitin deacetylase gene 1 and analysis of its amino acid sequence

[0014] 1. Acquisition of cDNA fragment of migratory locust chitin deacetylase gene 1

[0015] Based on the transcriptome database of migratory locusts, the Unigene was searched, and after NCBI Blastx analysis, a fragment of chitin deacetylase gene 1 of migratory locusts was determined to be obtained.

[0016] 2. Acquisition of full-length cDNA sequence of migratory locust chitin deacetylase gene 1

[0017] The above gene fragments were spliced ​​by GeneDoc software, and primer premier5.0 software was used to design the upstream primer CAACGTCACAACCAGTGAGTGTC (SEQ ID NO: 3) and the downstream primer GCGGTACACGATGAAAGATGG (SEQ ID NO: 4), which were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd. .

[0018] The 5th-instar migratory locust nymphs with healthy growth, uniform size, and half male and half male were selected, ...

Embodiment 2

[0021] Example 2: dsRNA synthesis of migratory locust chitin deacetylase gene 1

[0022] 1. Design of primers for chitin deacetylase gene 1dsRNA of migratory locust

[0023] Based on the chitin deacetylase gene sequence of migratory locust, it was designed using primer premier5.0 software. dsRNA primers were designed, the sequences of which were taatacgactcactatagggTCTGTAACGGCGAGAAGGAC (SEQ ID NO: 5) and taatacgactcactatagggCCATCATGGTGAACTGGTTG (SEQ ID NO: 6) (the part in italics is T7 promoter). All primers were synthesized by Shanghai Yingwei Jieji Biological Co., Ltd.

[0024] 2. Synthesis of specific dsRNA from migratory locust chitin deacetylase gene 1

[0025] Using the above chitin deacetylase gene 1 extraction plasmid as a template, PCR amplification was performed with upstream and downstream primers containing the T7 promoter sequence. A 586bp gene fragment (SEQ ID NO: 7) was obtained, and the PCR product was purified using the Gel Extraction Kit (Omega) kit accord...

Embodiment 3

[0026] Embodiment 3: dsRNA kills migratory locust experiment of migratory locust chitin deacetylase gene 1

[0027] 1. Specific dsRNA injection

[0028] A total of 28 5th-instar 2-day-old nymphs with healthy growth, uniform size, and half male and half male were selected for the experiment. 2.5 μl (6.25 μg) of synthetic dsRNA was gently injected into the flank between the second and third abdominal segments of the nymph using a 25 μl gauge microsyringe. At the same time, 28 nymphs were selected as the control group, and the same volume and concentration of dsGFP were injected into the control group. The injected migratory locusts were reared in a 30°C constant temperature biochemical incubator (light:dark time=14h:10h, temperature 30±2°C, humidity 60%), and fed fresh wheat seedlings and wheat bran every day.

[0029] 2. Detection of silencing of migratory locust chitin deacetylase gene 1

[0030]Nine nymphs injected with dsGFP and dsLmCDA124h were collected for total RNA ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a full-length sequence of insect chitin deacetylate enzyme genes 1 (CDA1) and an application of the insect chitin deacetylate enzyme genes 1 in farm pest control. A fragment of the chitin deacetylate enzyme genes 1 is acquired from a migratory locust transcriptome by virtue of a bioinformatics method, and the full length of the gene with the sequence of SEQ ID NO.1 is further acquired. The dsRNA of the gene is designed and synthesized according to the sequence SEQ ID NO.1, and after the dsRNA is injected into a migratory locust body cavity, a target gene can be specifically silenced, so that the old skin of the migratory locust is difficult to remove, and the migratory locust dies. The death rate reaches more than 94.7 percent by virtue of a plurality of experiments. Due to the specificity and high-efficiency death rate, the important significance for the pest control can be realized, and a novel way can be provided for the pest control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to migratory locust chitin deacetylase gene 1 (CDA1) and its application in pest control. Background technique [0002] Migratory locust is an important agricultural pest in my country, and its large-scale migration has caused serious harm to agricultural production. At present, its control mainly relies on chemical control. Long-term application of chemical insecticides leads to a series of problems, such as environmental pollution, resistance development and harm to non-target organisms. Therefore, it is extremely urgent to develop new and alternative chemical control methods. [0003] RNA interference (RNAi) is a phenomenon of specific post-transcriptional gene silencing caused by double-stranded RNA molecules. Since winning the Nobel Prize in 2006, RNAi technology has been a research hotspot in life sciences. RNAi is not only a powerful tool to study gene function, but also has g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/80C12N15/113C12N15/10A01N57/16A01P7/04
Inventor 张建珍于荣荣张敏李大琪马恩波
Owner SHANXI XINYUAN HUAKANG CHEM
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More