Method for silencing IFNARI gene in DF-1 cell line
A DF-1 and cell line technology, applied in DNA/RNA fragments, recombinant DNA technology, genetic engineering, etc., can solve the problems of insufficient amount of vaccine antigen and high production cost, and solve the problem of insufficient amount of antigen and high production cost , the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] 1. Screening of siRNA that interferes with IFNAR1 gene transcription
[0033] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with IFNAR1 gene
[0034] According to the IFNAR1 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5'-AAATGTGGCTAATTTCTGTGT-3' (SEQ No.1); sh2: 5'-TA CGACGATAATACCTCCAA-3' (SEQ No.2); sh3: 5' -TAGGATCACAGAAGAAGTAAA-3' (SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG (SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and antisense strand, and introduce linker sequences at both ends, and form shRNA by anneali...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap