A method of silencing the ifnar2 gene in the df‑1 cell line
A cell line, DF-1 technology, applied in DNA/RNA fragmentation, recombinant DNA technology, genetic engineering and other directions, can solve the problems of insufficient antigen quality and high production cost of vaccines, and solve the problem of insufficient antigen quality and high production cost. , the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] 1. Screening of siRNA that interferes with IFNAR2 gene transcription
[0033] 1. Design and synthesis of oligonucleotide sequence of siRNA interfering with IFNAR2 gene
[0034] According to the IFNAR2 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5′-AATAACCTCTGTAGAGATCAT-3′ (SEQ No.1); sh2: 5′-AA AGACACGGATAGTGAGTTA-3′ (SEQ No.2); sh3: 5′- TACACAAGGCGTGATATCGTA-3'(SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG(SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and a reverse The sense strand is introduced into the adapter sequence at both ends, and shRNA is...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com