A method of silencing the ifnar2 gene in the df‑1 cell line
A cell line, DF-1 technology, applied in DNA/RNA fragmentation, recombinant DNA technology, genetic engineering and other directions, can solve the problems of insufficient antigen quality and high production cost of vaccines, and solve the problem of insufficient antigen quality and high production cost. , the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] 1. Screening of siRNA that interferes with IFNAR2 gene transcription
[0033] 1. Design and synthesis of oligonucleotide sequence of siRNA interfering with IFNAR2 gene
[0034] According to the IFNAR2 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5′-AATAACCTCTGTAGAGATCAT-3′ (SEQ No.1); sh2: 5′-AA AGACACGGATAGTGAGTTA-3′ (SEQ No.2); sh3: 5′- TACACAAGGCGTGATATCGTA-3'(SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG(SEQ No.4), according to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and a reverse The sense strand is introduced into the adapter sequence at both ends, and shRNA is...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap