Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting BRAF gene mutation and detecting method thereof

A kit and gene technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of easy pollution, positive results cannot be confirmed specific unknowns, etc., achieve strong specificity, clear and objective result interpretation, good safety effect

Inactive Publication Date: 2015-07-15
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method can detect both known and unknown mutation sites, and the sensitivity is about 5%. However, the reaction tube needs to be opened during the detection process, which is easy to cause pollution, and the positive result cannot confirm the specific unknown, and finally needs to be confirmed by sequencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting BRAF gene mutation and detecting method thereof
  • Kit for detecting BRAF gene mutation and detecting method thereof
  • Kit for detecting BRAF gene mutation and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] BRAF gene negative quality control product is BRAF gene unmutated human blood genomic DNA, then diluted to 10ng / μL concentration (the copy number is about 10 3 ). The BRAF gene positive quality control product is connected to the pUC57-Amp vector by the mutation sequence of the BRAF gene V600E mutation site, and then transformed into Escherichia coli, extracted and purified, and then diluted to a concentration of 10 3 Copy number (concentration is about 10 -5 ng / μl). The mutation site information comes from the Cosmic database, and the sequence of the mutation site was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The specific sequence is as follows:

[0038] ttatagaaattagatctcttacctaaactcttcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacacctcagatatatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagagaaatctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggtaagaattgaggctatttttccactgattaaatttttggccctgagatgctgctgag。

[0039] Then design primers f...

Embodiment 2

[0057] The minimum detection limit of the BRAF gene V600E mutation site was analyzed using the optimized detection system and reaction program. The research on the minimum detection limit mainly includes the following two aspects: 1) Research on the minimum detection limit of mutation ratio: the ratio of the lowest mutant DNA that can be detected under a certain DNA concentration; 2) Research on the minimum detection limit of DNA concentration: The lowest DNA concentration that can be detected under a certain ratio; 3) The research results of the lowest detection copy number.

[0058] 1) Research on the minimum detection limit of mutation ratio

[0059] First, accurately dilute the V600E mutation positive quality control and Control quality control, and uniformly dilute to 10 3 Copy number, the dilution is 10ng / ul wild-type DNA; then the positive quality control product and 10ng / ul negative genome according to the volume ratio of 0:100, 0.01:99.99, 0.5:99.5, 1:99 and 5:95 Mi...

Embodiment 3

[0076] 10 tissue samples from patients with colorectal cancer and matched preoperative plasma samples were collected from the First Affiliated Hospital of Zhejiang University School of Medicine. Immediately after sample collection, store in a -80°C refrigerator. The DNA in the tissue samples and the free DNA (cf-DNA) in the plasma were extracted using Qiagen kits, and subjected to agarose gel electrophoresis and concentration determination.

[0077] Then use the method of Example 1 to detect the tissue samples of 5 cases of colorectal cancer patients with V600E mutation detected and verified by tissue sequencing method, 5 cases of colorectal cancer patients without V600E mutation detected and verified by tissue sequencing method, and 10 healthy people. and plasma samples, the results are shown in Table 6.

[0078] Table 6, adopt the method of the present invention to detect colorectal cancer patient result

[0079]

[0080]

[0081] Note: "-" means that the sample V600...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting BRAF gene mutation and a detecting method thereof. The kit comprises a special probe which is modified by LNA locked nucleic acid and used for BRAF gene mutation sites; the special probe can be combined with wild type DNAs, a sample containing 0.01% BRAF gene mutation DNAs can be detected, and the minimum detectability ranges from 2 copies to 5 copies. The detecting method has the advantages that as for BRAF gene mutation detection, the specificity is high, the flexibility is high, pollution is small, operation is easy and rapid, and the safety performance is high; the detecting method is particularly suitable for detecting gene mutation from body fluid such as plasma, urine and saliva with low mutation content, and is suitable for early screening and diagnosis of colorectal cancers, and guidance is provided for personalized medicines.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for detecting BRAF gene mutation, and also relates to a method for detecting BRAF gene mutation in non-disease diagnosis by using the kit. Background technique [0002] The BRAF gene is the downstream gene of Ras, belongs to the RAF gene family, and is located at 7q34. The encoded BRAF protein consists of 783 amino acids and has three conserved regions of CR1, CR2, and CR3. It is the same as the BRAF protein Ras-Raf-MEK-ERK An important upstream regulator in the signaling pathway. This enzyme transduces the signal from Ras to MEK1 / 2, MEK1 / 2 then activates ERK1 / 2, and the activated ERK can affect nuclear factor KB and cyclin D1 to enhance their expression. Among them, the CR1 region contains the Ras protein binding region and the cysteine-rich region, and the CR3 region is the ATP binding site and activation region, with multiple phosphorylation sites, among which T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2525/117C12Q2547/101
Inventor 王弢李宗飞孙爱娟李杰张丽
Owner JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More