Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs

A cell line and overexpression technology, applied in the field of medicine and biology, can solve problems such as difficult to achieve satisfactory economic benefits, achieve strong anti-apoptotic properties, and increase cell viability

Inactive Publication Date: 2015-09-02
THE THIRD AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Adenovirus is a transient transfection, a large amount of adenovirus is required to modify MSCs with a therapeutic dose of adenovirus vector, and its economic benefit ratio is difficult to achieve satisfaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs
  • Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs
  • Cell strain MSCs for overexpression of Nrf2 gene as well as preparation method and application of cell strain MSCs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. PCR technology to amplify the open reading frame (open reading frame, ORF) of human Nrf2 (derived from human embryonic kidney cells)

[0032] 1.1 Primer design

[0033] Find the Gene ID of Nrf2 on NCBI: 4780, look for the forward primer before the start codon (atg) of its ORF, and look for the reverse primer after the stop codon (tag), and then reverse complement it to get the reverse primer . Add XbaI and BamHI restriction sites and protective bases in front of the forward primer and reverse primer respectively. The primer sequences are as follows:

[0034] Forward primer Fw: CGA TTCTAGA TTCCTGCTTTATAGCGTGCAAA

[0035] Reverse primer Rv: ATAT GGATCCTCACATCACAGTAGGAGCTT

[0036] The PCR products of the primers designed by NCBI-Blast comparison function prediction have better specificity, and there is only one product, namely the Nrf2ORF fragment, such as image 3 shown.

[0037] 1.2PCR amplification

[0038] Template: Use 293FT as a template, TRIZOL method ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cell strain MSCs for overexpression of an Nrf2 gene as well as a preparation method and application of the cell strain MSCs. The preparation method comprises the following steps: performing PCR amplification on a human-derived Nrf2 gene ORF; performing purification and double enzyme digestion on the PCR product obtained in the step (1), then connecting the PCR product with the framework plasmid pLV-CMV-XbaI-BamHI-GFP to construct an Nrf2 slow virus recombinant vector, and after conversion, selecting clone and determining positive clone; sequencing the positive clone, and after no mutation is determined, performing amplification massively; leading the recombinant vector and an auxiliary plasmid in a 293 FT cell to obtain a virus; using the virus to infect the 3-5 th generation hUC-MSCs cells so as to obtain the cell strain MSCs for overexpression of the Nrf2 gene. According to the invention, the overexpression of Nrf2 in MSCs is stably performed to increase the cell activity, and a higher anti-apoptosis feature is also realized under the anoxic and oxidative stress conditions; Nrf2-MSCs with the treatment level amount is obtained in vitro and can serve as an excellent tool cell for preclinical study of MSCs and can be used for preparing a medicine for enhancing preclinical study of MSCs transplanting.

Description

Technical field: [0001] The invention belongs to the field of medicine and biology, and in particular relates to a cell line MSCs overexpressing Nrf2 gene and its preparation method and application. Background technique: [0002] The transcription factor NF-E2-related factor 2 (Nrf2), a transcription factor acting on antioxidant response elements (AREs) upstream of biphasic metabolic enzyme genes, is a master regulator of the expression of a variety of cytoprotective genes. Two-phase metabolic enzymes or two-phase antioxidant enzymes mainly include heme oxygenase (HO-1, heat shock protein 32), quinone oxidoreductase (NQO1), glutathione transferase (GST), etc. The expression of biphasic metabolic enzymes is mainly regulated by the Keap1-Nrf2-ARE pathway. ARE is located in the 5' promoter region of almost all biphasic enzyme genes, and a variety of different types of substances can induce the transcription of biphasic enzyme genes through ARE. Under normal conditions, Nrf2 i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C12Q1/02A61K35/28A61P9/10A61P11/00A61P37/06
Inventor 汪国营杨扬张琪李华吴小材姜楠汪根树张剑
Owner THE THIRD AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More