Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of rhodococcus equi virulence gene VapA recombinant protein

A technology of Rhodococcus equi and recombinant protein, applied in the direction of antibacterial immunoglobulin, antibacterial drugs, bacterial antigen components, etc., can solve the problems of difficult medical diagnosis and treatment product development and application, and achieve the effect of good immunogenicity

Active Publication Date: 2015-09-09
SOUTH CHINA AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, although there are reports on the expression of some recombinant VapA proteins, most of the expressed proteins exist in the form of inclusion bodies, which is difficult to apply to the development and application of actual medical diagnosis and treatment products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rhodococcus equi virulence gene VapA recombinant protein
  • Application of rhodococcus equi virulence gene VapA recombinant protein
  • Application of rhodococcus equi virulence gene VapA recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction and Identification of Prokaryotic Expression Recombinant Plasmid PMAL-VapA

[0041] 1. Resuscitation and cultivation of Rhodococcus equi: Purchase Rhodococcus equi preserved in the American Type Culture Collection with the preservation number ATCC 33701, and recover Rhodococcus equi according to the prescribed operating procedures.

[0042] 2. Primer design: According to the VapA sequence of the Rhodococcus equi pathogenic gene (JN990991.1) in the NCBI gene bank and the pZeroBack / blunt and PMAL-C5x vector restriction sites, use OLigo6.0 software to design a pair of enzyme cutting sites The primers (synthesized by Shanghai Invitage Biotechnology Co., Ltd.), the primer sequences are as follows:

[0043] F: AAGGAAAAAAA GCGGCCGC ATGAAGACCCTGCACAAGACGGTCTC (underlined as not I restriction site)

[0044] R: CCG GAATTC CTAAGCGTTGTGCCAACTACCCGAG (underlined as EcoR I restriction site)

[0045] 3. PCR amplification and cloning of VapA ge...

Embodiment 2

[0088] Example 2 Expression of soluble MBP-VapA recombinant protein and determination of optimal induction conditions

[0089] Inoculate the positive BL21 bacterial liquid transformed with PMAL-VapA plasmid into LB liquid medium (containing ampicillin 50 μg / ml) at a ratio of 1:100, and culture in a shaker at 37°C at 200 r / min. To bacterial solution OD 600 When the value is about 0.6, optimize the expression of MBP-VapA recombinant protein according to the following method.

[0090] 1. Determination of temperature for inducing expression

[0091] IPTG at a concentration of 1 mM was added, and cultured with shaking at 10°C, 15°C, 20°C, 28°C and 37°C, respectively, until the appropriate induction time was taken. The sample was centrifuged at 4000r / min for 10 min, the supernatant was discarded, the precipitate was taken, and the precipitate was resuspended with 1 / 10 of the original volume of deionized water, and the expression of the fusion protein was detected b...

Embodiment 3

[0120] Example 3 Preparation of rabbit hyperimmune serum against Rhodococcus equi VapA

[0121] 1. Antibody preparation

[0122] The immune antigen was selected from the fusion protein MBP-VapA obtained through prokaryotic expression and purification in Example 2 of the present invention.

[0123] Experimental animals: SPF grade male New Zealand white rabbits (1.5-2kg), SPF Kunming mice (18-22g), provided by the Experimental Animal Center of Guangzhou Southern Medical University.

[0124] The preparation method is as follows:

[0125] Basic immunization: Fully emulsify with purified fusion protein MBP-VapA and Montanide Gel 01 ST adjuvant (final concentration ratio: 8%). Rabbits were injected subcutaneously on the back of the neck, and 1.0mL of antigen emulsion (containing about 1mg of antigen) was injected at multiple points, with an average of 0.2mL per point; mice were injected intraperitoneally, with a dose of 200uL of antigen emulsion (containing about 200ug of an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnical field, and particularly discloses an application of a rhodococcus equi virulence gene VapA recombinant protein to preparing a preparation for treating or detecting rhodococcus equi. The application is characterized in that the rhodococcus equi virulence gene VapA recombinant protein is MBP-VapA with an MBP label, wherein an amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 1; the obtained recombinant protein almost exists in a soluble expression form. The recombinant protein has good immunogenicity, and is suitable for developing biotechnical products such as hyper-immune serum antibodies for clinical treatment, vaccines, clinical diagnosis reagents and the like.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically, relates to the application of Rhodococcus equi pathogenic gene VapA protein. Background technique [0002] Rhodococcus equi belongs to the genus Rhodococcus and is an opportunistic pathogenic bacteria that are zoonotic. The pathogen is ubiquitous in the soil of the natural environment, and the survey shows that the bacteria exists in 50-95% of the farm soil. Rhodococcus equi can infect humans, causing respiratory symptoms. It is also one of the most common diseases in young foals, with an incidence rate of up to 80%. Affected foals generally present with symptoms of chronic or subacute bronchopneumonia, sometimes with cecal and mesenteric lymph node ulcers. [0003] The pathogenic mechanism of Rhodococcus equi has been unclear until recent studies have found that the key to the virulence of the bacterium is whether it contains a pathogenicity-related plasmid. The plasmi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/02A61P31/04C07K16/12
Inventor 孙凌霜龚凤平贾坤李守军
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com