Lentiviral vector with efficient infectivity and multiplication capacity promoting effect for T cells and hematopoietic stem cells

A carrier and recombinant virus technology, applied in the field of medical biology, can solve the problems of complex experimental procedures and low infection efficiency

Active Publication Date: 2015-09-09
SHANGHAI JI KAI GENE TECH CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still problems of low infection efficiency and complicated experimental procedures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector with efficient infectivity and multiplication capacity promoting effect for T cells and hematopoietic stem cells
  • Lentiviral vector with efficient infectivity and multiplication capacity promoting effect for T cells and hematopoietic stem cells
  • Lentiviral vector with efficient infectivity and multiplication capacity promoting effect for T cells and hematopoietic stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0155] Example 1: Construction of recombinant lentiviral vector

[0156] The construction of the recombinant lentiviral vector is based on the viral packaging helper plasmid H2 (purchased from Addgene, namely pVSV-G) carrying the VSVG gene.

[0157] Construction of FN-p-VSVG recombinant lentiviral vector:

[0158] a) obtain the FN-p gene fragment:

[0159] Whole gene synthesis of signal peptide-6His-FN-p-flexible peptide fragment (the signal peptide nucleotide sequence information is SEQ ID NO.: 8, the 6His nucleotide sequence information is SEQ ID NO.: 9, FN-p nucleoside The acid sequence information is SEQ ID NO.: 3, the flexible peptide nucleotide sequence information is SEQ ID NO.: 10), using the whole gene synthesis plasmid as a template, design the FN-p gene primer, forward primer 1 (5'TTCCTCGACGGATCC CTCGAG ATGAAGTGCCTTTTGTACTTAGCCTTTTTATTCATTGG3', SEQ ID NO.:11) and reverse primer 2 (5'TGGTGAACTTTGAACCGCCTCCGCTCGAGCCAC3', SEQ ID NO.:12), PCR amplification, PCR con...

Embodiment 2

[0204] Example 2: Packaging of recombinant lentiviruses

[0205] 1. Supply HEK-293T cells (purchased from ATCC) according to the 24h passage cycle, change the medium before transfection, and use an electric pipette to replace 5ml of DMEM medium containing 2% FBS for each plate of cells.

[0206] 2. To prepare a transfection system, add plasmid H1 (purchased from Addgene, 12 μg / dish, the same below for a 10 cm cell culture dish), plasmid H2 (the total amount of H2 plasmid is 10 μg / dish, in this example, Recombinant and wild-type H2 plasmids in different ratios), vector plasmid (lentiviral vector containing exogenous genes, purchased from Addgene, 24 μg / plate), CaCl 2 (50μl / plate), and finally add 2×HBS (500μl / plate) dropwise while shaking on a vortex shaker, and the transfection system is 1ml / plate. The recombinant H2 is a 1:1 mixture of FN-p-VSVG recombinant plasmid and CS1-VSVG recombinant plasmid.

[0207] 3. Pipette the transfection system carefully, mix well, take 1000 μ...

Embodiment 3

[0211] Example 3: Recombinant lentivirus infection of T lymphocytes

[0212] Infection experiments were performed according to conventional methods known to those skilled in the art. A brief description of the infection steps is as follows:

[0213] 1. Peripheral blood mononuclear lymphocytes (PBMC) were obtained through the blood apheresis system > 1x10 7 cells.

[0214] 2. Use complete medium (TexMACS medium + 5% autologous serum) to adjust part of the cell suspension so that the final concentration is 0.7 × 10 6 / ml, and add interleukin 2 (IL-2), penicillin (penicillin) and streptomycin (streptomycin), OKT3 and bovine serum albumin (BSA), so that the final concentration is 600IU / ml, 100U / ml, 100μg / ml and 0.2%.

[0215] 3. Gently mix the resuspended cells, take out 0.4ml of cell suspension (total cell volume 0.28×10 6 ) into a 1.5mL centrifuge tube.

[0216] 4. Add the required virus, and calculate the amount of virus added according to the MOI of 10.

[0217] 5. Gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for constructing a lentiviral vector with efficient transfection capacity and efficient bioactivity expression capacity. Experimental results show that the viral infection efficiency can be increased by 30-70% by using the method; in addition, the inventor unexpectedly finds that the proliferation of the T cells can also be effectively stimulated by using the technical scheme, and furthermore the treatment process of CAR-T cells is simplified, and the cost is reduced.

Description

technical field [0001] The invention belongs to the field of medical biotechnology, in particular, the invention relates to a method for constructing a lentiviral vector with high-efficiency transfection ability and high-efficiency expression of biological activity. Background technique [0002] With the development of biotechnology, genetic engineering (genetic engineering) is more and more widely used in medicine. Genetic engineering is based on the theory of molecular genetics, using modern methods of molecular biology and microbiology as means, to construct hybrid DNA molecules in vitro according to the pre-designed blueprint of genes from different sources, and then introduce them into living cells to change biological Pre-existing genetic traits, acquisition of new varieties, technologies for producing new products. Genetic engineering technology provides a powerful means for the study of gene structure and function. [0003] For the genetic modification of mammalian...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K14/145C07K14/78C12N15/62C12N5/10
Inventor曹跃琼王庆亮张晓慧黄经纬朱向莹
OwnerSHANGHAI JI KAI GENE TECH CO LTD