Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Saccharomyces cerevisiae engineered strain expressing pectin esterase and application of strain

A technology of Saccharomyces cerevisiae and pectin esterase, which is applied in the field of fermentation engineering, can solve problems such as high viscosity of mash, blockage of conveying pipelines, and impact on ethanol production, and achieve the effects of reducing equipment burden, saving energy consumption, and reducing viscosity

Active Publication Date: 2015-11-04
JIANGNAN UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Starch raw material is the main raw material for the production of fuel alcohol. There are many viscous substances such as colloid and pectin in the raw material. When fermented at high concentration, the viscosity of the mash is very high, and the mass and heat transfer capacity of the fermented liquid is poor, which seriously affects the effect of enzymes. and Saccharomyces cerevisiae metabolic activity, affecting ethanol production
The high viscosity of mash will also block the transportation pipeline, increase the burden of equipment operation, increase the difficulty of solid-liquid separation in the later stage, and bring difficulties to the fermentation of alcohol thick mash

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae engineered strain expressing pectin esterase and application of strain
  • Saccharomyces cerevisiae engineered strain expressing pectin esterase and application of strain
  • Saccharomyces cerevisiae engineered strain expressing pectin esterase and application of strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of Saccharomyces cerevisiae PE

[0023] 1. Construction of recombinant plasmid pMGK-AG-PE containing pectin esterase coding gene

[0024] According to the kit operation steps, use the kit to extract the total RNA of Aspergillus niger and use it as a template to synthesize a strand of cDNA by reverse transcription, and design primers PEf: ATGGTTAAGTCAATTCTTGCATCCGT and PEr: TTAGTTGATGTAGCTAG according to the PE gene sequence (GenBank number is XM_001390469), and use A strand of cDNA was used as a template, and the complete pectin esterase gene without its own signal peptide was amplified by PCR and inserted into the SnaBI site of the vector pPIC9K to obtain the recombinant plasmid pPIC9k-PE. Design the upstream primer PE1 according to the nucleotide sequence of the alpha factor signal peptide in pPIC9K, design the downstream primer PE2 according to the PE gene sequence (GenBank number is XM_001390469), and introduce the EcoR I restriction site. The...

Embodiment 2

[0033] Embodiment 2 utilizes saccharomyces cerevisiae engineering bacterium PE fermentation sweet potato powder to produce alcohol

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
viscosityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae engineered strain expressing pectin esterase and application of the strain and belongs to the field of fermentation engineering. The saccharomyces cerevisiae engineered strain is characterized in that the encoding genes of the pectin esterase are fused with the encoding genes of alpha-lectin and then converted into saccharomyces cerevisiae, recombinant plasmids are integrated to the chromosome NDA of hosts to obtain the strain expressing the pectin esterase on the surfaces of cells in an anchored manner, and pectin esterase activity can reach 2.6U / g. When the strain is used for the alcohol fermentation production of raw materials such as sweet potatoes and cassavas, alcohol fermentation efficiency can be increased while fermentation liquor viscosity during fermentation can be evidently lowered, enzymatic action and saccharomyces cerevisiae metabolism are benefited, equipment burden can be lowered, and energy consumption can be reduced.

Description

technical field [0001] The invention relates to a strain of Saccharomyces cerevisiae strain expressing pectin esterase and application thereof, in particular to a strain of Saccharomyces cerevisiae strain expressing pectin esterase anchored on the cell surface and application thereof, belonging to the field of fermentation engineering. Background technique [0002] The depletion of fossil fuels and the global environmental protection requirements have brought good development opportunities for the fuel alcohol industry. Fuel alcohol is a renewable and clean energy source. Adding a certain proportion of alcohol to gasoline can significantly reduce the environmental pollution caused by vehicle exhaust. my country is the world's third largest producer of fuel ethanol after the United States and Brazil, with an annual output of 1.518 million tons and increasing year by year. Starch raw material is the main raw material for the production of fuel alcohol. There are many viscous ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P7/06C12R1/865
CPCY02E50/10
Inventor 陈献忠肖艳沈微
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com