Saccharomyces cerevisiae engineered strain expressing pectin esterase and application of strain
A technology of Saccharomyces cerevisiae and pectin esterase, which is applied in the field of fermentation engineering, can solve problems such as high viscosity of mash, blockage of conveying pipelines, and impact on ethanol production, and achieve the effects of reducing equipment burden, saving energy consumption, and reducing viscosity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Construction of Saccharomyces cerevisiae PE
[0023] 1. Construction of recombinant plasmid pMGK-AG-PE containing pectin esterase coding gene
[0024] According to the kit operation steps, use the kit to extract the total RNA of Aspergillus niger and use it as a template to synthesize a strand of cDNA by reverse transcription, and design primers PEf: ATGGTTAAGTCAATTCTTGCATCCGT and PEr: TTAGTTGATGTAGCTAG according to the PE gene sequence (GenBank number is XM_001390469), and use A strand of cDNA was used as a template, and the complete pectin esterase gene without its own signal peptide was amplified by PCR and inserted into the SnaBI site of the vector pPIC9K to obtain the recombinant plasmid pPIC9k-PE. Design the upstream primer PE1 according to the nucleotide sequence of the alpha factor signal peptide in pPIC9K, design the downstream primer PE2 according to the PE gene sequence (GenBank number is XM_001390469), and introduce the EcoR I restriction site. The...
Embodiment 2
[0033] Embodiment 2 utilizes saccharomyces cerevisiae engineering bacterium PE fermentation sweet potato powder to produce alcohol
PUM
Property | Measurement | Unit |
---|---|---|
viscosity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com