Normal-temperature and constant-temperature nucleic acid amplification method using fluorescence probe

A fluorescent probe, room temperature isothermal technology, applied in the field of molecular biology, can solve the problems of inability to achieve isothermal PCR and imprecise product quantification, and achieve the effect of increasing the detection accuracy and the detection rate

Inactive Publication Date: 2015-11-04
ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a fluorescent probe method at room temperature isothermal nucleic acid amplification method, to overcome the current fluorescent PCR relies heavily on precision instruments, and nucleic acid isothermal amplification technology can not achieve complete isothermal and PCR product quantification is not accurate enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Normal-temperature and constant-temperature nucleic acid amplification method using fluorescence probe
  • Normal-temperature and constant-temperature nucleic acid amplification method using fluorescence probe
  • Normal-temperature and constant-temperature nucleic acid amplification method using fluorescence probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] This example is used to illustrate the rapid fluorescence reaction at room temperature and constant temperature performed on the Twista instrument and the multifunctional fluorescent microplate reader BMG Omeg.

[0048] 1. According to NCBI GenBank and related literature reports, primers were designed based on the soybean internal reference gene EF 1b, and a pair of optimal primer pairs (SEQ ID No.6 / 7) was screened out from many primer pairs through experimental optimization. The increased fragment is 235bp (SEQ ID No.8) ( figure 2 ). Subsequently, the fragment was cloned into the plasmid pMD18-T to obtain the desired recombinant plasmid pMD18T-EF1b, which was used as a template for fluorescence detection.

[0049] EF1b-F: 5'-TCACACACACACATATAGAAAGAGAGAGAC-3' (SEQ ID No.6)

[0050] EF1b-R: 5'-CTGCTCCAGTTAGTTCATATAAGAGATAGG-3' (SEQ ID No. 7)

[0051] SEQ ID No. 8:

[0052] 5’-TCACACACACACATATAGAAAGAGAGAGACAATGGTTGTCAGCATCGTCCATTTCTTTTTAGACCAAAGATTTTAATGCAGTCAACTCTGC...

Embodiment 2

[0064] This example is used to illustrate the fluorescence detection of the MTB insertion sequence IS6110 gene on the Twista instrument.

[0065] 1. According to NCBI GenBank and related literature reports, a 523bp sequence (SEQ ID No.10) was selected from the insertion sequence IS6110 of MTB for gene synthesis, and cloned into the vector pUC57 to prepare a recombinant plasmid pUC57-6110. Template for fluorescence detection.

[0066] SEQ ID No. 10:

[0067] 5’-CTCCGACCGACGGTTGGATGCCTGCCTCGGCGAGCCGCTCGCTGAACCGGATCGATGTGTACTGAGATCCCCTATCCGTATGGTGGATAACGTCTTTCAGGTCGAGTACGCCTTCTTGTTGGCGGGTCCAGATGGCTTGCTCGATCGCGTCGAGGACCATGGAGGTGGCCATCGTGGAAGCGACCCGCCAGCCCAGGATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGACACATAGGTGAGGTCTGCTACCCACAGCCGGTTAGGTGCTGGTGGTCCGAAGCGGCGCTGGACGAGATCGGCGGGACGGGCTGTGGCCGGATCAGCGATCGTGGTCCTGCGGGCTTTGCCGCGGGTGGTCCCGGACAGGCCGAGTTTGGTCATCAGCCGTTCGACGGTGCATCTGGCCACCTCGATGCCCTCACGGTTCAGGGTTAGCCACACTTTGCGGGCACCGTAAACACCGTAGTTGGCGGCGTGGACGCGGCTGATGTGCTC-3’ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a normal-temperature and constant-temperature nucleic acid amplification method using a fluorescence probe. The normal-temperature and constant-temperature nucleic acid amplification method includes: under constant temperature, single-strand binding protein partially opens the double-strand parental strand into a single strand; recombinant enzyme is combined with primer to form complex, the complex is combined to the parental strand under the action of auxiliary protein, and the fluorescence probe is combined with a complementation area; DNA polymerase is combined to the 3' tail end of the primer to perform sub-strand extension; exonuclease identifies the tetrahydrofuran locus on the fluorescence probe under a double-strand state, fluorescent groups and quenching groups are separated after enzyme digestion to release fluorescence; after the fluorescence probe is cut off, the 3'-OH end originally sealed by probe 3' tail end modification is exposed, and DNA polymerase can continuously extend to form a sub-strand; qualitative and semi-quantitative detection can be performed on a to-be-detected sample by detecting the shape of an amplification curve and the strength of a fluorescence signal. The nucleic acid amplification method has the advantages that normal-temperature and constant-temperature detection can be performed, and qualitative and semi-quantitative detection can be performed on nucleic acid to-be-detected objects.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to a normal temperature isothermal nucleic acid amplification method of a fluorescent probe method, which is to perform rapid, real-time and accurate detection of nucleic acid targets under normal temperature conditions, and can be applied to many fields related to biological detection , such as clinical medicine, disease prevention and control, or food safety. Background technique [0002] In medicine, especially in the field of disease prevention and control, the rapid molecular detection of pathogens (including bacteria, viruses and parasites) by traditional nucleic acid in vitro amplification technology and polymerase chain reaction (PCR) has also experienced a long period of time. And after the process of continuous technological innovation, it has been highly recognized in the field of medical molecular diagnosis. The initial post-amplification agarose gel electrophoresis detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10C12Q1/68
Inventor李贤祯周国辉程奇
OwnerZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD