Trehalose synthase-trehalose hydrolase fusion enzyme, expression gene thereof and application

A technology of trehalose synthase and trehalose hydrolase, which is applied in the fields of genetic engineering and enzyme engineering, can solve the problems of high production costs, and achieve the effects of saving production time, reasonable activity ratio, and high-efficiency transformation

Inactive Publication Date: 2015-11-11
QILU UNIV OF TECH
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Although the double-enzyme method has many advantages above, there are still shortcomings: the two enzymes used in the double-enzyme method conversion need to be fermented and purified separately to obtain, so the production cost of the enzyme is significantly higher than that of the single-enzyme method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trehalose synthase-trehalose hydrolase fusion enzyme, expression gene thereof and application
  • Trehalose synthase-trehalose hydrolase fusion enzyme, expression gene thereof and application
  • Trehalose synthase-trehalose hydrolase fusion enzyme, expression gene thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Extraction of Arthrobacter sp. Genome Total DNA.

[0031] After a lot of screening, the inventor found a strain of Arthrobacter sp. QYW623 in a polluted farmland soil in the suburbs of Jinan City, Shandong Province. Based on trehalose hydrolase fusion enzyme activity, and after purification, the specific enzyme activity of the two enzymes is relatively close, the optimum temperature is around 55 ℃, and both have high catalytic activity between 5.0-5.8 (residual enzyme activity > 85 %), after cloning the gene sequences of maltooligosaccharide-based trehalose synthase and maltooligosaccharide-based trehalose hydrolase in the bacteria, it was found that the gene sequences of the two enzymes were similar to those in the Arthrobactersp.L77 genome (NZ_JWSU00000000.1) The gene sequences of the corresponding enzymes are relatively close, and the sequence identity is greater than 99%, but no one has studied its enzymatic properties.

[0032] Inoculate the Arthrobacte...

Embodiment 2

[0033] Example 2: Construction of maltooligosaccharide-based trehalose synthase-maltooligosaccharide-based trehalose hydrolase fusion enzyme gene

[0034] According to the genome sequence of Arthrobactersp. registered on NCBI, primers F1 and R1 (amplification of maltooligosaccharide-based trehalose synthase), F2 and R2 (amplification of maltooligosaccharide-based trehalose hydrolase) were designed respectively. The primer sequences are as follows:

[0035] F1:GAATTCGTGTTGACACCGAAATCGACCTACC

[0036] R1CCTCGGGGGTGAACGTGC

[0037] F2: ATGAGTTCGCCATTCGAGGT

[0038] R2: GCGGCCGCGTCGAGCAGGTGGATGGAGG

[0039] Using the total DNA prepared in Example 1 as a template, F1 and R1 as primers, using TaKaRaExTaq TM Perform PCR with the system provided in the manual;

[0040] The PCR conditions are: denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 54°C for 30 sec, extension at 72°C for 2.5 min, a total of 30 cycles; extension at 72°C for 10 min, storage at 4°...

Embodiment 3

[0049] Embodiment 3: the expression of fusion enzyme gene in Pichia pastoris

[0050] The vector used for the expression of Pichia pastoris is a vector that can realize intracellular (pPIC3.5K as an example) or extracellular (pPIC9K as an example) expression of Pichia pastoris.

[0051] The pMD18-MM plasmid was extracted and digested with EcoRI and NotI, and then ligated with pPIC3.5K and pPIC9K digested by the same two enzymes to obtain heterologous expression vectors pPIC3.5K-MM and pPIC9K-MM. After the vector was linearized by BglII, it was transformed into Pichia pastoris GS115 by electroporation (2500V, 5ms), and positive recombinants were screened by G418.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a trehalose synthase-trehalose hydrolase fusion enzyme, an expression gene thereof and application. Amino acid sequences of the maltooligosyl trehalose synthase-maltooligosyl trehalose tetrahydrolase fusion enzyme are shown as SEQ ID NO.2, and nucleotide sequences of the expression gene are shown as SEQ ID NO.1. The trehalose synthase-trehalose hydrolase fusion enzyme, the expression gene and the application have the advantages that the novel maltooligosyl trehalose synthase-maltooligosyl trehalose tetrahydrolase fusion enzyme is constructed by the aid of genetic engineering technologies and has the activity of maltooligosyl trehalose synthase and the activity of maltooligosyl trehalose tetrahydrolase, and accordingly production processes can be effectively simplified as compared with the traditional two-enzyme methods.

Description

technical field [0001] The present invention relates to a fusion enzyme of trehalose synthase-trehalose hydrolase and its expression gene and application, in particular to maltooligosaccharide-based trehalose synthase-maltooligosaccharide-based trehalose hydrolase fusion enzyme and its expression gene and application, belonging to Genetic engineering and enzyme engineering technical field. Background technique [0002] Trehalose is a ubiquitous non-reducing disaccharide linked by glucose through α-1,1 glycosidic bonds, among which α,α-1,1-trehalose has been isolated and found to be widely present in plants, in animals and microorganisms. Natural trehalose has a good and non-specific protective effect on organisms or biological macromolecules, enabling organisms with trehalose to survive harsh environments such as starvation, dryness, low temperature, high temperature, and radiation. With the increasing awareness of trehalose, the application of trehalose in various aspects...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N9/90C12N9/24C12N15/81C12N1/19C12P19/24C12P19/12C12P19/00
Inventor王腾飞汪俊卿王瑞明
OwnerQILU UNIV OF TECH