Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit for detecting peste des petits ruminants virus hemagglutinin protein antibody and application method of kit

A technology of Peste des petits ruminants and a kit, which is applied in the direction of viruses/bacteriophages, antisense single-stranded RNA viruses, viruses, etc., can solve the problem of low expression level, achieve good reaction specificity, be easy to popularize and apply on a large scale, and be simple to operate Effect

Inactive Publication Date: 2015-12-16
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In recent years, domestic and foreign scholars have used various expression systems to study the expression and function of H protein. This protein can be expressed in various expression systems, but due to the characteristics of the coding gene itself, the expression level is not high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Preparation of recombinant protein (tH protein) of hemagglutinin protein (H) extracellular region of Peste des petits ruminants virus (PPRV)

[0036] 1. Primer design

[0037] Primers were designed according to the extracellular region (tH) sequence of the H gene in the PPRVNigeria75 / 1 strain sequence (accession number: X74443) published in GenBank.

[0038] Upstream primer: 5'G GGATCC ATGAGGCTTCACCGAGCCACC3';

[0039] Downstream primer: 5'CC AAGCTT CTAGACTGGATTACATGTTACCTC3'.

[0040] Among them, the dashed parts are Bam H I and Hind Ⅲ Restriction site.

[0041] 2. RT-PCR amplification

[0042] (1) Extract cytotoxic RNA of Peste des petits ruminants vaccine strain Nigeria75 / 1;

[0043] (2) RT-PCR amplification to obtain tH fragment (1653bp). The nucleotide sequence of the tH fragment is shown in the sequence listing SEQ ID No.1.

[0044] The specific reaction system and reaction conditions are as follows: reaction system: 0.5 μg total RNA in 25 μl to...

Embodiment 2

[0066] Example 2 Establishment of the indirect ELISA kit for detecting Peste des petits ruminants virus (PPRV) of the present invention

[0067] 1 material

[0068] 1.1 Antigen, antibody

[0069] Antigen: tH recombinant protein prepared in Example 1, field sheep serum collected from a border area in Xinjiang. PPRV standard positive serum was prepared by immunizing healthy sheep with Peste des petits ruminants vaccine, and standard negative serum was collected from healthy sheep that had not been immunized against Peste des petits ruminants.

[0070] 1.2 Reagents and consumables

[0071] The commercial PPRVcELISA kit was purchased from BDSL Company in the UK; 96-well microplate plate was purchased from Costar Company; bovine serum albumin (BSA) was purchased from Solarbio Company; horseradish peroxidase-labeled rabbit anti-goat IgG was purchased from Sigma Company; The standard substrate TMB was purchased from Promega Company; gelatin was purchased from Sigma Company; Twee...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a kit for detecting a peste des petits ruminants virus hemagglutinin protein (H protein) antibody. The kit takes recombinant protein of extracellular region sequence code of peste des petits ruminants virus hemagglutinin protein gene as an envelope antigen. The invention further provides an application method of the kit. The kit can quickly specifically detect the peste des petits ruminants virus H protein antibody in serum, and is good in reaction specificity and high in sensitivity. The operation is simple; the cost is low; and the reaction result is stable and reliable, and is easy to observe. The kit is suitable for monitoring the vaccine immunity effect of import and export immunity, food sanitation, and a livestock farm of peste des petits ruminants.

Description

technical field [0001] The invention relates to a kit for detecting antibodies to the hemagglutinin protein of Peste des Petits Ruminants virus and a method for using the same. Background technique [0002] Peste des petits ruminants is a Class I animal disease specified in the List of Statutory Animal Diseases formulated by the Ministry of Agriculture of my country. After the disease occurred successively in neighboring countries, the natural geographical barrier - the Himalayas was finally broken through. In 2007, the disease occurred in Tibet, my country, posing a serious threat to my country's animal health and safety. [0003] Since an outbreak of Peste des Petits Ruminants was diagnosed in the Ngari region of Tibet in 2007, so far, Peste des Petits Ruminants has occurred in more than 20 provinces including Xinjiang, Gansu, Inner Mongolia, and Guizhou. Peste des petits ruminants is endangering the development of the sheep industry in western my country, so monitoring a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/569G01N33/543C07K14/12C12N15/70
CPCG01N33/68C07K14/005C12N2760/18451G01N33/543G01N33/56983G01N2469/20
Inventor 窦永喜蒙学莲朱学亮才学鹏张志东
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More