Nucleic acid amplification reaction mixture particle and application thereof

A nucleic acid amplification reaction and mixture technology, applied in the field of nucleic acid amplification reaction mixture particles, can solve the problems affecting the efficiency of test operation, short storage time at room temperature, easy inactivation of active ingredients, etc., to expand the scope of use, prolong the storage time, The effect of reducing transportation and storage costs

Inactive Publication Date: 2016-01-27
GUANGZHOU HUAFENG BIOTECH
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem that the existing nucleic acid amplification reaction reagents are stored for a short time at room temperature and their active ingredients are easily

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid amplification reaction mixture particle and application thereof
  • Nucleic acid amplification reaction mixture particle and application thereof
  • Nucleic acid amplification reaction mixture particle and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] 1. Prepare the nucleic acid amplification reaction mixture

[0042] 1) Prepare 100 nucleic acid amplification reaction reagents required for the ring-mediated isothermal amplification reaction system, a total of 1000 μL. The components and contents of the nucleic acid amplification reaction reagents are shown in the following table:

[0043] components

[0044] Among them, the Bst nucleic acid polymerase produced by Guangzhou Huafeng Biotechnology Co., Ltd. has extremely high activity and purity. The Bst nucleic acid polymerase enzyme solution does not contain glycerol. In order to increase the stability of the enzyme solution, the enzyme solution contains 2% ( w / v) trehalose.

[0045] Wherein, the primers in the table are primers for amplifying Mycobacterium tuberculosis, and the sequences of each primer are:

[0046] inner primer

[0047] FIP: GCCTCTACCAGTACTGCGGCTTTTGAGCGTAGTAGGCAGCT;

[0048] inner primer

[0049] BIP:GTTGAACCAGTCGACCCAGCGTTTTAACCCGGCA...

Embodiment 2

[0060] 1. Prepare the nucleic acid amplification reaction mixture

[0061] 1) Prepare a total of 1500 μL of nucleic acid amplification mixture required for 100 ring-mediated isothermal amplification reaction systems. The components and amounts of the nucleic acid amplification reaction mixture are shown in the following table:

[0062] components

[0063] Wherein, the Bst nucleic acid polymerase and primer sequences are the same as in Example 1.

[0064] 2) Prepare lyoprotectant

[0065] Weigh 0.1 g of sucrose and 0.05 g of polyvinylpyrrolidone and place them in a tube.

[0066] 3) Add the nucleic acid amplification reaction reagent in step 1) to the tube in 2), shake well and mix to form a nucleic acid amplification reaction mixture, wherein the weight volume of sucrose and polyvinylpyrrolidone and the nucleic acid amplification reaction mixture The specific concentration is 10%, and the mixed liquid reagent for the nucleic acid amplification reaction is clear and...

Embodiment 3

[0074] 1. Prepare the nucleic acid amplification reaction mixture

[0075] 1) with the step 1) of embodiment 1);

[0076] 2) Prepare lyoprotectant

[0077] Weigh 0.12g of sucrose and 0.08g of BSA (bovine serum albumin) and place them in a tube.

[0078] 3) Add the nucleic acid amplification reaction reagent in step 1) to the tube in 2), shake well and mix to form a nucleic acid amplification reaction mixture, wherein the weight-volume ratio concentration of sucrose and BSA to the nucleic acid amplification reaction mixture is 20%, until the nucleic acid amplification reaction mixture is clear and transparent.

[0079] 4) The nucleic acid amplification reaction mixture in step 3) is divided into PCR tubes according to the sample volume of 10ul using an automatic sample loading device. When adding samples, the tubes should be placed on a frozen tray, and the tray temperature is at At 4°C, the difference between tubes was 1%.

[0080] 2. Preparation of nucleic acid amplificat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a nucleic acid amplification reaction mixture. The nucleic acid amplification reaction mixed liquor is prepared by freeze drying and is in freeze-drying granular shape, and the water content is 0.1-3%; the nucleic acid amplification reaction mixed liquor at least contains necessary components for a nucleic acid amplification reaction and a freeze-drying protective agent; the freeze-drying protective agent is a mixture containing one or more substances from sucrose, trehalose, glucose, glucan, saccharosan, bovine serum albumin, collagen, polyvinyl pyrrolidone, polyethylene glycol and carboxymethylcellulose sodium, and the weight volume ratio concentration of the freeze-drying protective agent and the nucleic acid amplification reaction mixed liquor is 5%-20%. The nucleic acid amplification reaction mixture freeze-drying particles have compact and tight particle and smooth appearance, and fine apertures are contained in the particles and can be observed under microscopic amplification state; the freeze-drying particles can be stored at room temperature for more than one year with unchanged reaction activity, the biological reaction activity is not changed at 40-45 DEG C, and during usage, a reconstitution fluid is added for rapidly dissolving the particles and recovering the reaction activity.

Description

technical field [0001] The invention belongs to the field of nucleic acid amplification reaction, and in particular relates to a nucleic acid amplification reaction mixture particle which can be stored for a long time at room temperature and is easily soluble, and an application thereof. Background technique [0002] Many components in the nucleic acid amplification reaction system are unstable under relatively high temperature conditions, such as nucleic acid polymerase, primers, dNTP, etc., all need to be stored under refrigerated conditions, such as below -20°C. These reaction components are generally stored at low temperature alone or in a partially mixed manner, but even frozen conditions cannot maintain the biological activity of these components for a long time, and it takes a long time to thaw or subpackage on an ice box. , The repeated freezing and thawing of the reagent will further affect the biological activity of the active ingredient. Moreover, long-term cryop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12M1/24
Inventor 黄昱阳杜正平熊槐谭慧媚曹以诚
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap