Nucleic acid amplification reaction mixture particle and application thereof
A nucleic acid amplification reaction and mixture technology, applied in the field of nucleic acid amplification reaction mixture particles, can solve the problems affecting the efficiency of test operation, short storage time at room temperature, easy inactivation of active ingredients, etc., to expand the scope of use, prolong the storage time, The effect of reducing transportation and storage costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] 1. Prepare the nucleic acid amplification reaction mixture
[0042] 1) Prepare 100 nucleic acid amplification reaction reagents required for the ring-mediated isothermal amplification reaction system, a total of 1000 μL. The components and contents of the nucleic acid amplification reaction reagents are shown in the following table:
[0043] components
[0044] Among them, the Bst nucleic acid polymerase produced by Guangzhou Huafeng Biotechnology Co., Ltd. has extremely high activity and purity. The Bst nucleic acid polymerase enzyme solution does not contain glycerol. In order to increase the stability of the enzyme solution, the enzyme solution contains 2% ( w / v) trehalose.
[0045] Wherein, the primers in the table are primers for amplifying Mycobacterium tuberculosis, and the sequences of each primer are:
[0046] inner primer
[0047] FIP: GCCTCTACCAGTACTGCGGCTTTTGAGCGTAGTAGGCAGCT;
[0048] inner primer
[0049] BIP:GTTGAACCAGTCGACCCAGCGTTTTAACCCGGCA...
Embodiment 2
[0060] 1. Prepare the nucleic acid amplification reaction mixture
[0061] 1) Prepare a total of 1500 μL of nucleic acid amplification mixture required for 100 ring-mediated isothermal amplification reaction systems. The components and amounts of the nucleic acid amplification reaction mixture are shown in the following table:
[0062] components
[0063] Wherein, the Bst nucleic acid polymerase and primer sequences are the same as in Example 1.
[0064] 2) Prepare lyoprotectant
[0065] Weigh 0.1 g of sucrose and 0.05 g of polyvinylpyrrolidone and place them in a tube.
[0066] 3) Add the nucleic acid amplification reaction reagent in step 1) to the tube in 2), shake well and mix to form a nucleic acid amplification reaction mixture, wherein the weight volume of sucrose and polyvinylpyrrolidone and the nucleic acid amplification reaction mixture The specific concentration is 10%, and the mixed liquid reagent for the nucleic acid amplification reaction is clear and...
Embodiment 3
[0074] 1. Prepare the nucleic acid amplification reaction mixture
[0075] 1) with the step 1) of embodiment 1);
[0076] 2) Prepare lyoprotectant
[0077] Weigh 0.12g of sucrose and 0.08g of BSA (bovine serum albumin) and place them in a tube.
[0078] 3) Add the nucleic acid amplification reaction reagent in step 1) to the tube in 2), shake well and mix to form a nucleic acid amplification reaction mixture, wherein the weight-volume ratio concentration of sucrose and BSA to the nucleic acid amplification reaction mixture is 20%, until the nucleic acid amplification reaction mixture is clear and transparent.
[0079] 4) The nucleic acid amplification reaction mixture in step 3) is divided into PCR tubes according to the sample volume of 10ul using an automatic sample loading device. When adding samples, the tubes should be placed on a frozen tray, and the tray temperature is at At 4°C, the difference between tubes was 1%.
[0080] 2. Preparation of nucleic acid amplificat...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap